Skip to main content
Download PDF

NID1 promotes laryngeal cancer stemness via activating WNT pathway

Biology Direct volume 19, Article number: 115 (2024) Cite this article

Abstract

Background

Laryngeal cancer (LCA) is one of the most common head and neck squamous cell carcinoma with poor outcome. LCA stem cells are the main reason for LCA therapy resistance and relapse. Understanding the molecular mechanisms of the self-renew of LCA stem cells is critical to develop now targets and strategies for LCA therapy.

Methods

Q-PCR and western blotting assays were used to determine NID1 level in LCA tissues and normal laryngeal tissues. MTT, colony formation assay, apoptosis assay and animal model were used to investigate the effect of NID1 on radiotherapy resistance. Side population assay and sphere formation assay were used to determine the role of LCA in the self-renew of LCA stem cells.

Results

NID1 was upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients, and associated with had poor outcome. NID1 knockdown suppressed radiotherapy resistance and the self-renew of LCA stem cells, while NID1 overexpression promoted radiotherapy resistance and the self-renew of LCA stem cells. Further analysis showed that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. Moreover, NID1 level was positively correlated with nuclear β-Catenin level in LCA tissues.

Conclusion

Our results show that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway, providing a novel potential target for LCA treatment.

Introduction

Laryngeal cancer (LCA) is one of the most common head and neck squamous cell carcinoma (HNSCC). Laryngeal surgery, radiotherapy, chemotherapy, and immunotherapy have been used to treat LCA. However, their curative effect still is limited, and the 5-year survival rate is below 40% [1, 2]. Cancer stem cells (CSCs) which are a subpopulation cells containing in multiple kinds of tumors characterized with self-renewal ability. CSCs are the main reasons for tumor recurrence, metastasis, therapeutic resistance of radiotherapy and chemotherapy [3]. Many studies demonstrated that LCA CSCs play critical role in LCA recurrence, metastasis, and therapeutic resistance. Side population, CD24, ALDH, and CD133 have been used to identify and sort LCA CSCs [4]. Exploring the key genes and molecule mechanisms of regulating the self-renew of LCA stem cells will provide potential targets for developing LCA therapeutic strategies. Although some genes have been found to regulate LCA stem cells self-renews, such as PLOD2 [5], BMI1 [6], and DGCR5 [7]. However, the LCA CSCs regulating genes, and their molecular mechanisms are largely unknown.

Nidogen-1 (NID1) is a secreted protein and regulates tumor-stroma crosstalk during tumor metastasis and has been demonstrated to regulate various tumors progression. NID1 has been demonstrated to promote lung metastasis of HCC, colorectal cancer, breast cancer, and melanoma via multiple molecular mechanisms [8,9,10]. However, the role and molecular mechanisms of NID1 regulating LCA therapeutic resistance and the self-renew of LCA stem cells have not been studied. Here, we found NID1 was overexpressed in relapsed LCA tissues and associated with poor outcome of LCA patients. Furthermore, NID1 promotes LCA radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. We provided novel potential target for LCA treatment.

Materials and methods

Cell culture

LCA cell lines FaDu, Hep-2, TU212 and TU686 were purchased from ATCC (Manassa, VA, USA) and cultured using DMEM medium supplemented with 10% fetal bovine serum (FBS, F103-01, Vazyme, Nanjing, China). Human hypopharyngeal normal primary cell was cultured using human hypopharyngeal normal primary cell medium (M36074-04 S, Celprogen, CA, USA). These cells were maintained in a humidified incubator at 37 ℃ with 5% CO2. For radiotherapy resistance assay, LCA cells were seeded at 96 or 6-well plates, and irradiated with a linear accelerator dose of 0, 2, 4, 6, 8–10 Gy.

Tissues samples

This study was approved by the Ethics Committee of Guangdong Provincial People’s Hospital. Written informed consent was obtained from all patients and all samples were collected according to the informed consent. The detailed Ten pairs of LCA tissues and adjacent normal tissues were collected. In addition, we collected 80 LCA tissues to determine the correlation between NID1 level and LCA patients’ prognosis. The detailed information was shown in Supplementary Table 1.

Vectors and stable cell lines construction

To knockdown NID1, we subcloned the shRNAs sequence into the lentivirus PLKO.1-Puro (Addgene, #8543). The target sequences were shown as follows: shNID#1: 5’ GCAGTCTACGTCACCACAAAT 3’; shNID#2: 5’ CCAGAAGGTATCGCTGTTGAT3’; shTCF4#1: 5’ CGAATTGAAGATCGTTTAGAA3’; shTCF4#2: 5’ GAAAGGAATCTGAATCCGAAA 3’; shLEF#1: 5’ GCACGGAAAGAAAGACAGCTA 3’; shLEF#2: 5’ CCATCAGATGTCAACTCCAAA3’. To overexpress NID1, we subcloned the CDS sequence of NID1 into the lentivirus vector pCDH-CMV-Pur. To construct the stable cell line. We packaged the lentivirus via co-transfecting the transfer vectors with pMD2.G and psPAX2 into 293T cells using Lipofectamine 2000 (11668019, Thermo, Waltham, MA, USA). The lentivirus supernatant was collected at 48 h and 72 h after transfection, and infected interesting LCA cell line. Puromycin (T19978, TargetMol, Boston, MA, USA) was used to screen stable cell lines.

Q-PCR

Total RNA was isolated from cells using FreeZol Reagent (R711-02, Vazymes, Nanjing, China). RNA reverse transcription was performed using HiScript III RT SuperMix for qPCR (R323, Vazyme, Nanjing, China). Q-PCR was carried out using ChanQ Blue Universal SYBR qPCR Master Mix (Q312, Vazyme, Nanjing, China) on a LightCycler 480 Real-Time PCR System (Roche, Rotkreuz, Switzerland). The relative mRNA levels were calculated using 2-ΔΔCt method. GAPDH was used as the internal control. All experiments were carried out in triplicate. The primer sequences for Q-PCR were shown as follows: NID1, Forward: 5’ ACTCCAGGCTCTTTCACGTG3’; Reverse: 5’ GAATGTGTTCTCGCTCGTGC3’. MYC, Forward: 5’ CATCAGCACAACTACGCAGC3’, Reverse: 5’ CGTTGTGTGTTCGCCTCTTG3’. CD44, Forward: 5’ GAGCAGCACTTCAGGAGGTT3’’; Reverse: 5’ CTGTCTGTGCTGTCGGTGAT3’. SNAI1, Forward: 5’ ATGAGGACAGTGGGAAAGGC3’’; Reverse: 5’ ATCCTTGGCCTCAGAGAGCT3’. RUNX2, Forward: 5’ CAGCCTCTTCAGCACAGTGA3’’; Reverse: 5’ CTCACGTCGCTCATTTTGCC3’. CCND1, Forward: 5’ GAGCTGCTCCTGGTGAACAA3’; Reverse: 5’ TGTTTGTTCTCCTCCGCCTC3’.

Western blot

Total proteins were extracted from cells or tissues by RIPA Lysis and Extraction Buffer (89900, Thermo, Waltham, MA, USA) supplemented with protease inhibitor cocktail (HY-K0011, MCE. NJ, USA). Protein concentration was determined by BCA Protein Assay Kit (23225, Thermo, Waltham, MA, USA). Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membrane. The membranes were blocked by 5% nonfat milk and incubated with primary antibodies for overnight at 4℃. After washing with TBST for three times, the membranes were incubated with HRP-conjunct secondary antibodies. After washing with TBST buffer, signals were detected by enhanced chemiluminescence. Antibodies that were used are the following: anti-NID1 antibody (MA5-23911, Thermo, Waltham, MA, USA), anti-cleaved Caspase-3 (ab2302, Abcam, Cambridge, UK), Cleaved PARP (ab32064, Abcam, Cambridge, UK), KLF4 (ab215036, Abcam, Cambridge, UK), OCT4 (ab181557, Abcam, Cambridge, UK), SOX2 (ab97959, Abcam, Cambridge, UK), NANOG (ab109250, Abcam, Cambridge, UK), β-Catenin (ab32572, Abcam, Cambridge, UK), EF1α (05-235, Merck, Darmstadt, Germany) and GAPDH (ab8245, Abcam, Cambridge, UK).

Immunofluorescence (IF)

Cells were fixed with 4% paraformaldehyde for 30 min at room temperature and permeabilized for 2 h at room temperature. Then cells were incubated with primary antibodies for overnight at 4℃. After washing with 2% FBS, cells were incubated with secondary antibodies conjugate with Alexa Fluor 488. The nuclei were stained with DAPI. The images were captured under a fluorescence microscope.

Apoptosis assay

LCA cells were seeded at 6-well plates and irradiated with a linear accelerator dose of 4 Gy. Then cells were digested into single cells using 0.25% trypsin (25200072, Thermo, Waltham, MA, USA) and performed apoptosis assay using PE Annexin V apoptosis Detection Kit with 7-AAD (640934, Biolegend, San Diego, CA, USA) according to the manufacturer’s protocol.

MTT assay

For cell viability assay, LCA cells were seeded at 96-well plates and irradiated with a linear accelerator dose of 0, 2, 4, 6, 8, 10 Gy. The MTT was added to each well and incubated with cells for 4 h. Then, the supernatant was removed, DMSO was added to dissolve the precipitate. Absorbance was determined by a spectrophotometer at 490 nm.

Colony formation assay

LCA cells were seeded at 6-well plates and irradiated with a linear accelerator dose of 4 Gy. 10 days after the treatment, cells were fixed with 4% paraformaldehyde, stained with 1% crystal violet, and photographed.

10 side population (SP) assay

Cells were dissociated into single cells using 0.25% trypsin and resuspended using 2% FBS. Subsequently, Hoechst 33,342 dye (HY-15559 A, MCE, NJ, USA) was added and incubated with cells for 90 min under shaking in 37℃. The control cells were incubated with 50µM verapamil (T20656, TargetMol, Boston, MA, USA) for 15 min at 37℃ before addition of Hoechst 33,342 dye. The percentage of Hoechst 33,342-labeled cells were analyzed using a flow cytometer (Cytek Aurora, Cytek, Fremont, CA, USA). SP cells were visualized by red vs. blue ultraviolet channels in linear mode.

Sphere formation assay

Cells were dissociated into single cells using 0.25% trypsin and seeded in 6-well ultralow attachment culture plates. Cells were cultured by DMEM/F12 medium supplemented with 2% B-27 (17504044, Thermo, Waltham, MA, USA), 0.4% BSA (A8010, Solarbio, Beijing, China), 20ng/ml bFGF (C046, Novoprotein, Shanghai, China), 20ng/ml EGF (C029, Novoprotein, Shanghai, China), 6 µg/ml Insulin (91077 C, Merch, Darmstadt, Germany) for 15 days. The numbers of spheres were counted under a microscope.

Animal model

5–6 weeks old male nude mice were purchased from Shanghai Model Organisms (Shanghai, China). All animal experiments were approved by the Ethical Committee of Guangdong Provincial People’s Hospital. Hep2 cells with NID1 overexpression or knockdown were injected into the abdominal cavity of nude mice. Ten days after injection, mice treated with radiotherapy at a dose of 20 Gy. 20 days after radiotherapy treatment, the tumors were sacrificed. Tumors were photographed and weighed. Proteins were extracted from tumor tissues for WB assay.

Statistical analysis

The statistical analysis was performed using SPSS 20.0 (IBM, NY, USA) and GraphPad Prism software (GraphPad Software, Boston, MA, USA). All experiments were independently repeated at least times and data are shown as the mean ± SD. Student’s t test was carried out to compare two groups. Kaplan-Meier curves and the log-rank test were performed survival analysis. GSEA was analyzed using online algorithm (https://www.gsea-msigdb.org/gsea/index.jsp). p < 0.05 indicated significant significance。 *p < 0.05, **p < 0.01, ***p < 0.0001.

Results

NID1 is elevated in LCA tissues and associated with poor outcome

To determine the role of NID1 in LCA therapeutic resistance and stem cell self-renew, we firstly determined NID1 levels in normal throat tissues and LCA tissues with/without recurrence using TCGA database and GSE27020. GSE27020 contains gene expression files of LCA tissues collected from 50 patients [11]. We found that NID1 was significantly upregulated in LCA tissues according to the TCGA database (Supplementary Fig. 1A). it also regulated in LCA tissues collected from patients with recurrence compared to those from patients without recurrence (Supplementary Fig. 1B). Then we integrated the TCGA database and GSE27020, and also found NID1 was significantly upregulated in LCA tissues with recurrence (Fig. 1A). Next, we determined NID1 level in LCA tissues and adjacent normal tissues (ANT). NID1 was elevated in LCA tissues both in mRNA and protein levels (Fig. 1B). We also determined NID1 expression in LCA cells and normal throat cells. Q-PCR and WB assay showed NID1 was significantly elevated in LCA cells (Fig. 1C). Importantly, Q-PCR and WB assay also demonstrated that NID1 was upregulated in LCA tissues with recurrence (Fig. 1D).

Fig. 1
figure 1

NID1 is upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients. (A) NID1 was upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients. (B) Q-PCR and western blotting assays showed that NID1 was upregulated in LCA tissues (T) compared to the adjacent normal tissues (ANT). (C) Q-PCR and western blotting assays showed that NID1 was upregulated in the LCA cells. (D) Q-PCR and western blotting assays showed that NID1 was upregulated in LCA tissues derived from relapsed patients compared to the non- relapsed patients. Data represents the mean ± SD, *p < 0.05

Full size image

Then, we determined the correlation between NID1 level and survival time of LCA patients. Kaplan-Meier analysis showed that patients with high NID1 level has shorter overall survival time or recurrence free survival time than those with low NID1 level (Fig. 2A). To confirm above results, we collected 80 LCA tissues. Kaplan-Meier analysis demonstrated that LCA patients with low NID1 level has longer overall survival time than those with high NID1 expression (Fig. 2B), Statistical analysis also showed NID1 was significantly highly expressed in tissues collected from relapsed LCA patients (Fig. 2B). Interestingly, we also found that NID1 was significantly upregulated in tissued collected from relapsed LCA patients compared to tissues collected from LCA patients without relapse among patients treated with radiotherapy after surgery, suggesting NID1 is associated with radiotherapy resistance (Supplementary Fig. 1C). GSEA analysis also showed that high NID1 expression was associated with LCA recurrence (Supplementary Fig. 1C). Together, these results show that NID1 is upregulated in LCA tissues and associated with LCA recurrence. NID1 might regulate radiotherapy resistance.

Fig. 2
figure 2

NID1 is associated with poor outcome of LCA patients. (A) Kaplan-Meier analysis for overall survival, and recurrence free survival based on the expression of NID1. Data were come from TCGA, GSE27020 and GSE25727 databases. (B) Kaplan-Meier analysis for overall survival based on the expression of NID1. (C) The proportion of low NID1 or high NID1 level in LCA patients with or without Recurrence. Data represents the mean ± SD, ***p < 0.001

Full size image

NID1 increases the radiotherapy resistance of laryngeal cancer

To investigate the effect of NID1 on radiotherapy resistance, we downregulated or overexpressed NID1 in HEp-2 and TU212. Q-PCR and WB assay showed that NID1 confirmed that shRNAs against NID1 effectively inhibited NID1 expression and NID1 was significantly overexpressed in LCA cells infected with lentivirus containing NID1 overexpressing vector (Fig. 2A). Cell viability, colony formation and apoptosis assays showed that NID1 overexpression significantly increased radiotherapy resistance of LCA cells, while NID1 knockdown effectively inhibited radiotherapy resistance of LCA cells (Fig. 3B and D). We used a mouse model to confirm these results, we injected Hep2 cells with NID1 overexpression or knockdown into the abdominal cavity of nude mice. Ten days after injection, mice treated with radiotherapy at a dose of 20 Gy. 20 days after radiotherapy treatment, the tumors were sacrificed (Fig. 4A). We found that radiotherapy treatment didn’t reduce the size and weight of xenograft tumor with NID1 overexpression, while radiotherapy treatment could reduce the size and weight of xenograft tumor with NID1 knockdown (Fig. 4B and C). In addition, we determined the level of Cleaved Caspase-3 and Cleaved PARP in xenograft tumors. WB assay suggested that NID1 overexpression reduced their expression, while NID1 knockdown increased their expression (Fig. 4D). IHC staining also confirmed that NID1 overexpression enhanced β-Catenin level, while NID1 knockdown reduced β-Catenin level in xenograft tumors (Fig. 4E). These results demonstrate that NID1 inhibits the sensitivity of radiotherapy treatment for LCA.

Fig. 3
figure 3

NID1 promotes radiotherapy resistance in vitro. (A) Q-PCR and western blotting assays of the effect of NID1 shRNAs and overexpression vector. (B) Cell viability assay for the effect of NID1 knockdown or overexpression on radiotherapy. (C) Colony formation assay for the effect of NID1 knockdown or overexpression on radiotherapy. (D) Apoptosis assay for the effect of NID1 knockdown or overexpression on radiotherapy. Data represents the mean ± SD, *p < 0.05. **p < 0.01

Full size image
Fig. 4
figure 4

NID1 promotes radiotherapy resistance in vivo. (A) The schematic diagram for determining the effect of NID1 on radiotherapy using animal model. (B) The tumor sizes of xenograft tumor after radiotherapy treatment. (C) The tumor weights of xenograft tumor after radiotherapy treatment. (D) WB assay for the expression of Cleaved Caspase-3 and Cleaved RARP in tissues derived from xenograft tumor after radiotherapy treatment. (E) IHC staining assay for NID1 and β-Catenin in xenograft tumors. Scale bars, 60µM. Data represents the mean ± SD, **p < 0.01

Full size image

NID1 promotes the self-renew of laryngeal cancer stem cells

Cancer stem cells are the main reason for therapeutic resistance. We have found that NID1 promotes the resistance of radiotherapy for LCA, suggesting that NID1 might regulate LCA stem cells. To verify this hypothesis, we used side population and sphere formation assays to investigate the role of NID1 in the self-renew of LCA CSCs. Side population assay showed that NID1 overexpression increased the proportion of side population, while NID1 knockdown reduced the proportion of side population (Fig. 5A and Supplementary Fig. 1E). In addition, sphere formation assay showed that NID1 overexpression promoted sphere formation, while NID1 knockdown inhibited sphere formation (Fig. 5B). To confirm above results, we performed WB assay to investigate the effect of NID1 expression on the stemness factors and found NID1 overexpression increased KLF4, OCT4, SOX2 and NANOG expression, while NID1 knockdown inhibited their expression (Fig. 5C). GSEA assay also showed NID1 expression was significantly positively correlated with stemness (Fig. 5D). Together, these results show that NID1 promotes radiotherapy the self-renew of LCA stem cells.

Fig. 5
figure 5

NID1 promotes the self-renew of LCA stem cells. (A) Side populations assay for the effect of NID1 knockdown or overexpression on the self-renew of LCA stem cells. (B) Sphere formation assay for the effect of NID1 knockdown or overexpression on the self-renew of LCA stem cells. (C) WB assay for the expression of KLF4, OCT4, SOX2 and NANOG in LCA cells with NID1 knockdown or overexpression. (D) GSEA assay for the relation between NID1 expression and stem cell regulating genes. Data represents the mean ± SD, *p < 0.05. **p < 0.01

Full size image

NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway

To determine the regulatory mechanisms of NID1 promoting radiotherapy resistance and the self-renew of LCA stem cells, we found that NID1 level was positive correlation with WNT pathway activity (Fig. 6A). TOP/FOR luciferase reporter assay suggested that NID1 overexpression significantly promoted the luciferase activity, while NID1 knockdown significantly reduced the luciferase activity (Fig. 6B). WB and IF assays showed that NID1 overexpression promoted the β-Catenin nuclear translocation, while NID1 knockdown inhibited the nuclear translocation of β-Catenin (Fig. 5C and D). We also determined the expression of target genes of WNT pathway upon NID1 overexpression or knockdown. We found NID1 overexpression increased MYC, CD44, SNAI1, RUNX2 and CCND1 expression, while NID1 knockdown inhibited their expression (Fig. 6E), confirming NID1 regulates WNT pathway.

Fig. 6
figure 6

NID1 activates WNT pathway. (A) GSEA assay for the relation between NID1 expression and WNT pathway. (B) Luciferase reporter assay for the effect of NID1 on WNT pathway activation. (C) WB assay for the effect of NID1 on the nuclear location of β-Catenin in LCA cells. (D) IF assay for the effect of NID1 on the nuclear location of β-Catenin in LCA cells. (E) The effect of NID1 on the expression of the downstream genes of WNT pathway. Data represents the mean ± SD, **p < 0.01

Full size image

To confirm NID1 promotes LCA radiotherapy resistance and the self-renewal of LCA stem cells via activating WNT pathway. We knocked down TCF4 and LEF1 in NID1 overexpressing LCA cells (Supplementary Fig. 1F). Colony formation and apoptosis assays showed that TCF4 or LEF1 knockdown inhibited radiotherapy resistance caused by NID1 overexpression (Fig. 7A and B). Sphere formation assay showed that TCF4 or LEF1 knockdown inhibited sphere formation ability caused by NID1 overexpression (Fig. 7C). In addition, we determined the correlation between the levels of NID1 and nuclear β-Catenin in LCA tissues and revealed that NID1 level was positively correlated with nuclear β-Catenin level, confirming NID1 promotes WNT pathway (Fig. 7D). Taken together, these findings demonstrate that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway.

Fig. 7
figure 7

NID1 promotes LCA radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. (A) Colony formation assay for the effect of inhibition of WNT pathway on radiotherapy resistance in NID1-overexpressing LCA cells. (B) Apoptosis assay for the effect of inhibition of WNT pathway on radiotherapy resistance in NID1-overexpressing LCA cells. (C) Sphere formation assay for the effect of inhibition of WNT pathway on radiotherapy resistance in NID1-overexpressing LCA cells. (D) The correlation between NID1 expression of nuclear β-Catenin in LCA tissues determined by WB assay. Data represents the mean ± SD, **p < 0.01

Full size image

Discussion

In the present study, we aimed to study the effect of NID1 on LCA radiotherapy resistance and the self-renew of LCA stem cells. We showed that NID1 was significantly upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients. LCA patients with high NID level had poor outcome. NID1 promoted radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. Moreover, NID1 level was positively correlated with nuclear β-Catenin level in LCA tissues.

NID1 is a key secreted basement membrane protein and involved in many disease development, such as human cytomegalovirus infection [12], Hirschsprung’s disease [13], diabetic kidney disease [14]. NID1 has been reported to regulate tumor growth and metastasis of various kinds of tumors via multiple mechanisms, for example, secreting NID1 induces EMT of colorectal cancer via a p53/miR-192/215/NID axis [15]. The role of NID1 in LCA hasn’t been reported. Radiotherapy is a standard treatment method for most tumor therapy, including LCA. However, radiotherapy resistance is the main challenge for LCA therapy. Understanding its regulatory mechanisms is critical to predict and overcome radiotherapy resistance [16]. Thus, we studied the role of NID1 in LCA radiotherapy resistance. We found that NID1 promoted LCA radiotherapy resistance via cell viability assay, apoptosis assay and animal models. Furthermore, we investigated the role of NIN1 in the self-renew of LCA stem cells, which is a main reason for radiotherapy resistance generation. We found that NID1 promoted the self-renew of LCA stem cells via side population assay and sphere formation assay. Taken together, our results demonstrate that NID1 promotes LCA radiotherapy resistance and the self-renew of LCA stem cells, providing a novel potential target for LCA therapy.

WNT pathway activation has been demonstrated as a critical driver in tumor initiation and progression [17, 18]. WNT pathway could be activated in LCA by some factors, such as LncRNA UCA1 [19], and PRMT5/Wnt4 axis [20]. We found that NID1 could activate WNT pathway via determining the nuclear β-Catenin level and the expression of the targets of WNT pathway. Furthermore, inhibition of WNT pathway could reverse the effect of NID1 overexpression on LCA radiotherapy resistance and the self-renew of LCA stem cells. Thus, our study demonstrates that NID1 is a WNT pathway activator. NID1 promotes LCA radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway.

In summary, we NID1 serves as an oncogene in LCA by promoting radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. Inhibition of WNT pathway blocks the role of NID1 in radiotherapy resistance and the self-renew of LCA stem cells. Our results provide a potential target for LCA treatment.

Data availability

No datasets were generated or analysed during the current study.

References

  1. Igissin N, Zatonskikh V, Telmanova Z, Tulebaev R, Moore M, Laryngeal Cancer. Epidemiology, etiology, and Prevention: a narrative review. Iran J Public Health. 2023;52(11):2248–59. https://doiorg.publicaciones.saludcastillayleon.es/10.18502/ijph.v52i11.14025.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Xu J, Yang Y, Zhong Q, Hou L, Ma H, Zhang Y, et al. A study of Peripheral Blood parameters to predict response to Induction Chemotherapy and overall survival in Advanced Laryngeal squamous cell carcinoma. Curr Oncol. 2022;29(9):6472–84. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/curroncol29090509.

    Article  PubMed  PubMed Central  Google Scholar 

  3. Loh JJ, Ma S. Hallmarks of cancer stemness. Cell Stem Cell. 2024;31(5):617–39. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.stem.2024.04.004.

    Article  CAS  PubMed  Google Scholar 

  4. Greco A, Rizzo MI, De Virgilio A, Gallo A, Fusconi M, Pagliuca G, et al. Cancer stem cells in laryngeal cancer: what we know. Eur Arch Otorhinolaryngol. 2016;273(11):3487–95. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00405-015-3837-9.

    Article  CAS  PubMed  Google Scholar 

  5. Song M, Liu X, Li T, Zhang Y, Zhao X, Sun W, et al. Silencing PLOD2 attenuates cancer stem cell-like characteristics and cisplatin-resistant through integrin beta1 in laryngeal cancer. Transl Oncol. 2022;22:101460. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.tranon.2022.101460.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Chen H, Zhou L, Dou T, Wan G, Tang H, Tian J. BMI1’S maintenance of the proliferative capacity of laryngeal cancer stem cells. Head Neck. 2011;33(8):1115–25. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/hed.21576.

    Article  PubMed  Google Scholar 

  7. Tang T, Shan G. DGCR5 promotes cancer stem cell-like properties of radioresistant laryngeal carcinoma cells by sponging miR-506 via wnt pathway. J Cell Physiol. 2019;234(10):18423–31. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/jcp.28478.

    Article  CAS  PubMed  Google Scholar 

  8. Mao X, Tey SK, Yeung CLS, Kwong EML, Fung YME, Chung CYS, et al. Nidogen 1-Enriched extracellular vesicles facilitate extrahepatic metastasis of Liver Cancer by activating pulmonary fibroblasts to Secrete Tumor Necrosis Factor Receptor 1. Adv Sci (Weinh). 2020;7(21):2002157. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/advs.202002157.

    Article  CAS  PubMed  Google Scholar 

  9. Aleckovic M, Wei Y, LeRoy G, Sidoli S, Liu DD, Garcia BA, et al. Identification of Nidogen 1 as a lung metastasis protein through secretome analysis. Genes Dev. 2017;31(14):1439–55. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/gad.301937.117.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. Rokavec M, Jaeckel S, Hermeking H. Nidogen-1/NID1 function and regulation during progression and metastasis of Colorectal Cancer. Cancers (Basel). 2023;15(22). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/cancers15225316.

  11. Fountzilas E, Kotoula V, Angouridakis N, Karasmanis I, Wirtz RM, Eleftheraki AG, et al. Identification and validation of a multigene predictor of recurrence in primary laryngeal cancer. PLoS ONE. 2013;8(8):e70429. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0070429.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Kuan MI, Caruso LB, Zavala AG, Rana P, O’Dowd JM, Tempera I, et al. Human cytomegalovirus utilizes multiple viral proteins to regulate the Basement Membrane Protein Nidogen 1. J Virol. 2022;96(20):e0133622. https://doiorg.publicaciones.saludcastillayleon.es/10.1128/jvi.01336-22.

    Article  CAS  PubMed  Google Scholar 

  13. Zhu D, Xie H, Li H, Cai P, Zhu H, Xu C, et al. Nidogen-1 is a common target of microRNAs MiR-192/215 in the pathogenesis of Hirschsprung’s disease. J Neurochem. 2015;134(1):39–46. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/jnc.13118.

    Article  CAS  PubMed  Google Scholar 

  14. Khattab A, Torkamani A. Nidogen-1 could play a role in diabetic kidney disease development in type 2 diabetes: a genome-wide association meta-analysis. Hum Genomics. 2022;16(1):47. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s40246-022-00422-y.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Rokavec M, Bouznad N, Hermeking H. Paracrine induction of epithelial-mesenchymal transition between Colorectal Cancer cells and its suppression by a p53/miR-192/215/NID1 Axis. Cell Mol Gastroenterol Hepatol. 2019;7(4):783–802. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jcmgh.2019.02.003.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Larionova I, Rakina M, Ivanyuk E, Trushchuk Y, Chernyshova A, Denisov E. Radiotherapy resistance: identifying universal biomarkers for various human cancers. J Cancer Res Clin Oncol. 2022;148(5):1015–31. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s00432-022-03923-4.

    Article  CAS  PubMed  Google Scholar 

  17. Nusse R, Clevers H. Wnt/beta-Catenin signaling, Disease, and emerging therapeutic modalities. Cell. 2017;169(6):985–99. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cell.2017.05.016.

    Article  CAS  PubMed  Google Scholar 

  18. Parsons MJ, Tammela T, Dow LE. WNT as a driver and dependency in Cancer. Cancer Discov. 2021;11(10):2413–29. https://doiorg.publicaciones.saludcastillayleon.es/10.1158/2159-8290.CD-21-0190.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Sun S, Gong C, Yuan K. LncRNA UCA1 promotes cell proliferation, invasion and migration of laryngeal squamous cell carcinoma cells by activating Wnt/beta-catenin signaling pathway. Exp Ther Med. 2019;17(2):1182–9. https://doiorg.publicaciones.saludcastillayleon.es/10.3892/etm.2018.7097.

    Article  CAS  PubMed  Google Scholar 

  20. Wang N, Yan H, Wu D, Zhao Z, Chen X, Long Q, et al. PRMT5/Wnt4 axis promotes lymph-node metastasis and proliferation of laryngeal carcinoma. Cell Death Dis. 2020;11(10):864. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41419-020-03064-x.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was supported by the Initial Funding of the National Natural Science Foundation of China in 2020 (Surface Project) (No. 8207100247); Initial Funding of the National Natural Science Foundation of China in 2021 (Major Research Project) (No. 9215910127) and Science and Technology Program of Guangzhou City, China (No.202002020024). 

Author information

Author notes

  1. Wenlin Liu and Jie Wu contributed equally to this work.

Authors and Affiliations

  1. Department of Otorhinolaryngology, The Affiliated Qingyuan Hospital(Qingyuan People’sHospital),Guangzhou Medical University, No.35,Yinquan North Road, Qingyuan, Guangdong, 511518, P.R. China

    Wenlin Liu & Cuifang Chen

  2. Department of Otolaryngology Head and Neck Surgery, Guangdong Provincial People’s Hospital(Guangdong Academy of Medical Sciences), Southern Medical University, No.106, Zhongshan 2nd Road, Yuexiu District, Guangzhou, Guangdong, 510080, P.R. China

    Yuanpu Lai, Siyi Zhang, Yixuan Li & Zhongming Lu

  3. Department of Head and Neck Surgery, Sun Yat-sen University Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong, P.R. China

    Ankui Yang

  4. Department of Geriatrics, Guangdong Provincial Geriatrics Institute, Guangdong Provincial People’sHospital (Guangdong Academy of Medical Sciences), Southern Medical University, No.106, ZhongShan 2nd Road, YueXiu District, Guangzhou, Guangdong, 510080, P.R. China

    Jie Wu

Authors
  1. Wenlin Liu
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Jie Wu
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Yuanpu Lai
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Siyi Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Ankui Yang
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Yixuan Li
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Cuifang Chen
    View author publications

    You can also search for this author inPubMed Google Scholar

  8. Zhongming Lu
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

ZML, CFC and WLL designed all experiments, supervised the project.ZML wrote the manuscript.WLL, JW and YPL performed all the in vitro experiments. SYZ collected the specimens. YXL performed in vivo experiments and conducted IHC assay. WLL and AKY analysis and interpretation of data.All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Cuifang Chen or Zhongming Lu.

Ethics declarations

Ethical approval

All experimental procedures in studies involving animals were in accordance with the ethical standards of the Institutions at which the studies were conducted and were approved by Institutional Animal Care and Use Committee of Guangdong Provincial People’s Hospital.Prior patient consent and approval from the Institutional Research Ethics Committee of Guangdong Provincial People’s Hospital were obtained for the use of these clinical materials for research purposes.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Liu, W., Wu, J., Lai, Y. et al. NID1 promotes laryngeal cancer stemness via activating WNT pathway. Biol Direct 19, 115 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13062-024-00548-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13062-024-00548-0

Keywords

Biology Direct

ISSN: 1745-6150

Contact us