Skip to main content
Download PDF

MIR194-2HG, a miRNA host gene activated by HNF4A, inhibits gastric cancer by regulating microRNA biogenesis

Biology Direct volume 19, Article number: 95 (2024) Cite this article

Abstract

Background

MicroRNA host gene (MIRHG) lncRNA is a particular lncRNA subclass that can perform both typical and atypical lncRNA functions. The biological function of MIRHG lncRNA MIR194-2HG in cancer is poorly understood.

Methods

Loss-of-function studies were performed in vivo and in vitro to reveal the biological function of MIR194-2HG in GC. MicroRNA PCR array, northern blotting, RNA sequencing, chromatin immunoprecipitation, and rescue assays were conducted to uncover the molecular mechanism of MIR194-2HG.

Results

In this study, we reported an atypical lncRNA function of MIR194-2HG in GC. MIR194-2HG downregulation was clinically associated with malignant progression and poor prognosis in GC. Functional assays confirmed that MIR194-2HG knockdown significantly promoted GC proliferation and metastasis in vitro and in vivo. Mechanismically, MIR194-2HG was required for the biogenesis of miR-194 and miR-192, which were reported to be tumor-suppressor genes in GC. Moreover, hepatocyte nuclear factor HNF4A directly activated the transcription of MIR194-2HG and its derived miR-194 and miR-192. Meanwhile, BTF3L4 was proved to be a common target gene of miR-192 and miR-194. Rescue assay further confirmed that MIR194-2HG knockdown promotes GC progression through maintaining BTF3L4 overexpression in a miR-194/192-dependent manner.

Conclusion

The dysregulated MIR194-2HG/BTF3L4 axis is responsible for GC progression. Targeting HNF4A to inhibit miR-192/194 expression may be a promising strategy for overcoming GC.

Introduction

Gastric cancer (GC) is a heterogeneous tumor with the forth-highest mortality rate worldwide [1]. Over half of all GC cases around the world occur in East Asia every year [2]. Notably, South Korea, Japan, and China have the highest incidence rates of GC in the world [3, 4]. Thanks to the popularization of early cancer screening, the 5-year survival period of GC has significantly improved in recent years [5]. Nevertheless, due to the early asymptomatic and rapid progression of malignancy in GC, many patients are diagnosed at advanced stages [6]. It is imperative to explore and develop new diagnostic and prognostic markers for GC.

Long non-coding RNAs (lncRNAs) are a group of classic endogenous non-coding RNAs that play critical roles in multiple cellular events and diseases [7,8,9]. MicroRNA-host gene lncRNA (MIRHG) is a subclass of newly discovered lncRNAs derived from miRNA host genes due to pre-miRNA processing [10]. It is estimated that about 17.5% of miRNAs are generated by lnc-MIRHGs [11]. Studies have revealed that the maturation process of MIRHG transcripts is required for canonical miRNA production [12]. For example, Lu et al. have found that lncRNA MIR100HG, as well as its harbored miR-125 and miR-100 were significantly upregulated in cetuximab-resistant colorectal cancer and head and neck squamous cell cancer cell lines [13]. Yuan and colleagues have reported that LncRNA MIR17HG promotes colon cancer progression via activating Wnt/β-catenin signaling by upregulating the expression of miR-17 and miR-18a [14].

LncRNA MIR194-2HG, also known as ENSG00000229719 or AP001187.9, is located at chromosome 1q32.1. According to the annotation of the human genome, MIR194-2HG is a host gene of miR-194-5p (miR-194) and miR-192-5p (miR-192). Notably, it has been reported that both miR-192 and miR-194 play a tumor suppressive role in GC. For example, our team previously identified miR-194 as an optimal diagnostic and prognostic biomarker miRNA, which plays an inhibitory effect on GC cell growth by targeting oncogenic drivers [15, 16]. Similarly, Chiang and colleagues have shown that miR-192 down-regulation was clinically associated with increased tumor sizes, advanced Borrmann stage, and the degree of malignant progression (pT stage) in GC patients, indicating that miR-192 also plays a tumor suppressive role in GC [17].

Although the functions of miRNAs are usually well studied, their corresponding host lnc-MIRHGs remain an open area of investigation. So far, the biological function of lncRNA MIR194-2HG remains unknown in cancer. In this study, we uncovered a critical role of MIR194-2HG in GC. We found that MIR194-2HG and its derived miR-194 and miR-192 were transcriptionally regulated by HNF4A. More importantly, our finding highlights that MIR194-2HG inhibits GC progression by repressing the oncogenic driver gene BTF3L4 via enhancing the production of miR-194 and miR-192.

Results

MIR194-2HG is clinically correlated with a favorable prognosis in GC

We previously reported that miR-194 is specifically expressed in gastrointestinal cancer and plays an anti-tumor role [16]. As a host gene lncRNA of miR-194/192, MIR194-2HG is also selectively expressed in normal human colon, small intestine, and stomach tissues based on its expression pattern in the GTEx cohort (Fig. 1a). Expression analysis in our own GC cohort (n = 20) showed that MIR194-2HG transcripts were significantly reduced in GC (Fig. 1b). Similarly, the MIR194-2HG expression level in the normal gastric cell line GES-1 was higher than that in tumor cell lines (Fig. 1c), suggesting MIR194-2HG was significantly downregulated in GC. Next, the clinical significance of MIR194-2HG downregulation was further evaluated in the TCGA_STAD cohort. The results showed that the expression of MIR194-2HG in diffuse GC was lower than that in intestinal GC (Fig. 1d). Besides, the low expression of MIR194-2HG was clinically associated with poor differentiation and malignant progression of GC (Fig. 1e, f). However, there is no significant correlation between MIR-194-2HG expression and lymph node metastases (p = 0.53) and distance metastases (p = 0.90) in GC (Fig. 1g, h). Nevertheless, survival analysis showed that GC patients with lower expression of MIR194-2HG had a shorter overall survival time (P = 0.008, Fig. 1i) and disease-specific survival time (P = 0.023, Fig. 1j). Taken together, MIR194-2HG may act as a tumor suppressor gene in GC.

Fig. 1
figure 1

The clinical significance of MIR194-2HG overexpression in GC. (A) The expression pattern of MIR194-2HG in normal human tissues. (B, C) MIR194 was significantly upregulated in GC tissues (n = 42) and cell lines. (D-H) The clinical value of MIR194-2HG expression in GC was analyzed in the TCGA_STAD cohort. The expression level of MIR194-2HG in GC patients with different histological types (C), differentiation stages (D), T-stages (E), N-stages (F), and M-stages (G). (I, J) GC patients with lower expression of MIR194-2HG possessed shorter overall survival (OVS) and disease-specific survival (DSS). ***, P < 0.001; *, P < 0.05

Full size image

Knockdown of MIR194-2HG promotes GC cell proliferation, migration, and invasion

To verify this speculation, we originally considered conducting loss-of-function and gain-of-function studies in GC cell lines. However, according to the annotation of the human genome, lncRNA MIR194-2HG has three types of transcripts due to alternative splicing (Fig. 2a). That means the gain-of-function study of MIR194-2HG is relatively difficult to execute. On the contrary, the loss-of-function study can simultaneously target all the MIR194-2HG transcripts since they contain some common sequences. Based on the above reasons, we performed loss-of-function studies regarding MIR194-2HG in GC cell lines (Fig. 2b-m).

Fig. 2
figure 2

Knockdown of MIR194-2HG accelerated GC cell proliferation and metastasis. (A) The MIR194-2HG gene has three different transcripts due to alternative splicing. (B) The knockdown efficiency of MIR194-2HG in GC cell lines. (C) The effect of MIR194-2HG depletion on cell proliferation of GC cell lines. (D) The colony formation assay showed that MIR194-2HG depletion significantly increased the colony formation numbers of GC cell lines. (E) The edU staining assay showed that MIR194-2HG depletion significantly promoted proliferation of GC cell lines. (F) The cell cycle assay showed that knockdown of MIR194-2HG promotes the G1/S transition in GC cells. (G) Trypan blue staining results of Transwell invasion assay. (H): Transwell invasion assay showed that MIR194-2HG depletion significantly increased the invasion rate of GC cells. (I, J) The Wound healing assay confirmed that knockdown of MIR194-2HG obviously accelerated the migration rate of GC cell lines. (K) Xenograft tumor images of mice injected with AGS cells (day 30). (L, M) The weight (day 30) and volume of Xenograft tumor in different groups. ****, P < 0.0001; ***, P < 0.001; **, P < 0.01; *, P < 0.05

Full size image

To avoid the off-target effect, we designed two different shRNA sequences in lentiviral knockdown studies. The knockdown efficiency of MIR194-2HG in GC cell lines was determined by qRT-PCR assays (Fig. 2b). Then, the effect of MIR194-2HG knockdown on the biological behavior of GC cells was evaluated. The cell proliferation assay showed that MIR194-2HG depletion significantly accelerated the growth velocity of GC cells (Fig. 2c). Colony formation and the EdU assay together showed that MIR194-2HG knockdown significantly promoted GC cell proliferation (Fig. 2d, e). Cell cycle assays showed that MIR194-2HG knockdown facilitated the G1/S transition of GC cells (Fig. 2f). The transwell invasion assay showed that MIR194-2HG depletion significantly promoted the cell invasion rate of GC cell lines (Fig. 2g, h). Moreover, the wound healing assay showed that MIR194-2HG knockdown significantly promoted the cell migration rate of GC cell lines (Fig. 2i, j). Subcutaneous tumor experiment showed that knocking down MIR194-2HG significantly increased the weight and volume of xenograft tumors, suggesting MIR194-2HG depletion promoted GC progression in vivo (Fig. 2k-m). These results together indicate that MIR194-2HG plays a tumor-suppressive role in GC.

MIR194-2HG plays a positive role in regulating the microRNA biogenesis of miR-192 and miR-194

The biological function of lncRNAs is closely related to their subcellular location [18]. The RNA FISH assay showed that MIR194-2HG transcripts were mainly located in the cytoplasm of GC cells (Fig. 3a). Gene expression correlation analysis showed that miR-194 (r = 0.79, p < 0.001) and miR-192 (r = 0.73, p < 0.001) were the top2 microRNAs that co-expressed with MIR194-2HG in GC (Fig. 3b, c). The northern blotting assays further confirmed that MIR194-2HG knockdown impaired the expression levels of pre-mir-194/192 and mature miR-194/192 (Fig. 3d, e). Quantitative RT-PCR assay results also showed that MIR194-2HG knockdown significantly decreased the expression level of pre-mir-194/192 and mature miR-194/192 in GC cell lines (Fig. 3f-i). These evidences together indicated that MIR194-2HG exerts atypical lncRNA function by positively regulating the biogenesis of its derived microRNA-194/192 in GC.

Fig. 3
figure 3

MIR194-2HG was involved in miR-194/192 microRNA biogenesis. (A) The subcellular location of MIR194-2HG transcripts in GC cell lines. (B) The expression correlation analysis between MIR194-2HG and per microRNA was performed in GC. (C) MIR194-2HG was highly co-expressed with miR-194 and miR-192 in GC tissues. (D, E) Northern blotting assays showed that MIR194-2HG knockdown decreased the expression level of mature and precursor forms of miR-194 and miR-192. (F-I) Quantitative RT-PCR assay showed that MIR194-2HG knockdown significantly downregulated the expression level of pre-miR-192, miR-192, pre-miR-194-2, and miR-194 in GC cell lines

Full size image

HNF4A transcriptionally activates the expression of MIR194-2HG and its derived miRNAs

Furthermore, expression correlation analysis was conducted to understand the upstream regulatory mechanism of MIR194-2HG. We focus on transcription factors that can highly co-express with MIR194-2HG. The results showed that hepatocyte nuclear factor (HNF) family members (HNF4A, HNF4G, HNF1A, and HNF1B) were highly co-expressed with MIR194-2HG in the colon, small intestine, and stomach tissues (Fig S1a-c). Notably, hepatocyte nuclear factor 4α (HNF4A) had the highest expression correlation with MIR194-2HG in both normal stomach and GC tissues (R = 0.78, p < 0.001, Fig S1d-f). In addition, among the four HNF family members, HNF4A had the highest expression level in normal gastric tissue (Fig S1g). Survival analysis showed that HNF4A and HNF4G, but not HNF1A or HNF1B showed a significant correlation with GC prognosis (Fig S1h-k). Considering this evidence, we speculated that HNF4A may act as an upstream regulatory factor of MIR194-2HG.

To verify this speculation, we knocked down HNF4A expression in AGS cells and overexpressed HNF4A expression in SGC7901 cells. Quantitative RT-PCR and western blotting assays together indicated that HNF4A was successfully knocked down in AGS cells and successfully overexpressed in SGC7901 cells (Fig. 4a-c). Then, we investigated the expression level of MIR194-2HG after HNF4A knockdown or overexpression. As expected, MIR194-2HG expression level was significantly decreased in HNF4A-silenced GC cells and increased in HNF4A overexpression GC cells, suggesting that MIR194-2HG was positively regulated by HNF4A in GC (Fig. 4d, e).

Fig. 4
figure 4

HNF4A transcriptionally regulates MIR194-2HG expression. (A, B) The knockdown and overexpression efficiency of HNF4A were determined in GC cell lines by qRT-PCR assay. (C) Western blotting assays confirmed that the gain-of function and loss-of-function studies of HNF4A were successful. (D, E) Quantitative RT-PCR assay showed that MIR194-2HG was downregulated in HNF4A-silenced GC cells but upregulated in HNF4A overexpression GC cells. (F) Promoter analysis showed that MIR194-2HG contained an obvious HNF4A binding motif. (G) Chip-seq analysis showed that HNF4A directly binds to MIR194-2hg promoter in liver and colon cells. (H) Chip-qPCR assays showed that HNF4A directly binds to the promoter of MIR194-2HG. The Ubiquitin gene promoter DNA was used as an internal control. (I) MIR194-2HG was highly co-expressed with HNF4A in colon, stomach, and small intestine tissues

Full size image

As a transcription factor, HNF4A can directly regulate gene expression by binding to the promoter DNA. Thus, we predicted the possible HNF4A binding motif in the MIR194-2HG promoter using JASPAR web tool. The results showed that the MIR194-2HG gene promoter contains a putative HNF4A binding site (Fig. 4f). In addition, chip-seq analysis showed that HNF4A directly binds to MIR194-2HG promoter in colorectal, liver, and gastric cancer cell lines (Fig. 4g, h). Consistently, the expression levels of HNF4A and MIR194-2HG were highly co-expressed in human gastrointestinal tissues (R = 0.91, Fig. 4i). These results strongly suggested that the transcriptional activation of MIR194-2HG by HNF4A was conservative in human gastrointestinal tissues.

As MIR194-2HG was involved in microRNA-194/192 biogenesis, we further examined whether HNF4A can regulate the expression of miR-194/192 using the high-throughput microRNA PCR array (Fig. 5a). The results showed that miR-194 and miR-192 were the top two most significantly downregulated microRNAs (Fig. 5b). In addition, the miR-194 and miR-192 precursors were also downregulated in HNF4A-depleted GC cells, and upregulated in HNF4A-overexpression cells (Fig. 5c-f). Furthermore, expression correlation analysis showed that miR-194 and miR-192 were the top 2 miRNAs co-expressed with HNF4A in GC (Fig. 5g). Taken together, the expression of both MIR194-2HG and its derived miR-194 and miR-192 was transcriptionally activated by HNF4A in GC.

Fig. 5
figure 5

HNF4A positively regulated the expression of miR-192 and miR-194 in GC. (A) The microRNA PCR array was performed in the HNF4A-silenced GC cell line to show the effect of HNF4A depletion on miRNA expression. (B) Hsa-miR-194 and miR-192 were the most significantly downregulated miRNAs after HNF4A knockdown in the GC cell line SGC7901. (C-F) Knockdown of HNF4A significantly decreased the expression level of mature and precursor forms of miR-194 and miR-192, while overexpression of HNF4A significantly increased the expression level of mature and precursor forms of miR-194 and miR-192 in GC. (G) The expression correlation analysis was performed between HNF4A and miRNAs in the TCGA_STAD cohort. **, P < 0.0001

Full size image

BTF3L4 was a common target gene of miR-194 and miR-192

To figure out the molecular mechanism of MIR194-2HG, RNA sequencing studies were performed in GC cell lines transfecting with miR-194 mimics or miR-192 mimics. After overexpression of miR-194 or miR-192, the genes with the most significant changes in expression are shown in Table S1. We noticed an interesting phenomenon that there is a significant overlap between the downstream target genes of miR-192 and miR-194 (Fig. 6a). Notably, we previously reported that BTF3L4 was an oncogenic driver in GC and was putatively targeted by miR-194 [16]. Here we further observed that BTF3L4 expression was significantly downregulated after miR-194 or miR-192 overexpression (Fig. 6b).

Fig. 6
figure 6

BTF3L4 was the common target gene of miR-192 and miR-194 in GC. (A) The common differentially expressed genes of miR-192 and miR-194 were listed in the heat map. (B) RNA-seq analysis showed that BTF3L4 expression was downregulated by either miR-194 or miR-192 in GC cell lines. (C) Bioinformatics prediction showed that the 3’UTR of BTF3L4 contains the binding sites of miR-194 and miR-192. (D) Overexpression of miR-194 or miR-192, or both, significantly decreased the expression level of BTF3L4 in GC cell lines. (E) Western blotting assays showed that the overexpression of miR-194 or miR-192 significantly decreased the expression level of BTF3L4 in GC cell lines. (F-H) Luciferase reporter assays showed that BTF3L4 was directly targeted by miR-194 or miR-192. (I) Overall survival analysis showed that low expression levels of miR-194 or miR-192 predicted a poor prognosis in GC tissues. (J) BTF3L4 expression showed a significant negative correlation with miR-194/192 and MIR194-2HG in GC tissues. **, P < 0.01

Full size image

Consistently, bioinformatics prediction analysis using the miRcode web tool showed that the 3’UTR of BTF3L4 mRNA contained multiple miR-194 binding sites and one miR-192 binding site (Fig. 6c). The subsequent qRT-PCR and western blotting assays showed that BTF3L4 mRNA and protein were significantly downregulated by miR-194 or miR-192 in GC cell lines (Fig. 6d, e). Luciferase assays further confirmed that BTF3L4 was directly targeted by miR-194 or miR-192 (Fig. 6f-h). Survival analysis showed that low expression levels of miR-194 or miR-192 predicted a poor prognosis in GC (Fig. 6i). Expression correlation analysis showed that BTF3L4 expression was negatively correlated with miR-194/192 and MIR194-2HG in GC tissues (Fig. 6j). These results strongly implied that BTF3L4 was a common target gene of miR-194 and miR-192.

MIR194-2HG knockdown promotes GC progression by maintaining BTF3L4 overexpression

We previously reported that BTF3L4 played a oncogenic role in GC [16]. Here, we further analyzed the clinical significance of BTF3L4 in GC. First, BTF3L4 expression was significantly overexpressed in both the TCGA and GSE122401 cohorts (Fig. 7a, b). Besides, BTF3L4 overexpression was clinically associated with poor differentiation (G stage, p = 0.0028) and malignant progression (T stage, p = 0.04) in GC tissues (Fig. 7c, d). Moreover, BTF3L4 overexpression predicted poor prognosis in the TCGA and GSE62254 cohorts (Fig. 7e, f). These results indicated that BTF3L4 may act as an oncogene in GC.

Fig. 7
figure 7

MIR194-2HG inhibited GC progression via the miR-194/miR-192-BTF3L4 axis. (A) BTF3L4 expression was significantly upregulated in GC according to the RNA-seq data in the TCGA_STAD cohort. (B) BTF3L4 expression was significantly upregulated in GC according to the RNA-seq data in the GSE122401 cohort. (C, D) BTF3L4 expression was positively correlated with poor differentiation (G-stages) and malignant progression (T-stages) of GC. (E) BTF3L4 overexpression predicted a poor relapse-free survival in the TCGA_STAD cohort. (F) BTF3L4 overexpression predicted poor prognosis in GSE62254 cohort. (G, H) Knockdown of MIR194-2HG significantly upregulated mRNA and protein levels of BTF3L4 in GC cell lines. (I, J) Knockdown of BTF3L4 restored the promoting effect of MIR194-2HG depletion on the proliferation of GC cell lines. (K, L) Knockdown of BTF3L4 partially restored the promoting effect of MIR194-2HG depletion on the invasion of GC cell lines

Full size image

Additionally, qRT-PCR and western blotting assays showed that MIR194-2HG knockdown significantly upregulated the mRNA and protein levels of BTF3L4 in GC cell lines (Fig. 7g, h). Thus, we speculated that MIR194-2HG knockdown might promote GC progression through maintaining BTF3L4 overexpression. To verify this speculation, rescue colony formation and transwell invasion assays were performed in GC cell lines. The results showed that knockdown of BTF3L4 significantly recovered the promotion effect of MIR194-2HG knockdown on GC cell proliferation and invasion (Fig. 7i-l).

In summary, we proposed a working model regarding the biological role of MIR194-2HG in GC (Fig. 8). Briefly, MIRHG lncRNA MIR194-2HG was transcriptionally induced by HNF4A and positively regulated microRNA biogenesis of miR-194 and miR-192. Oncogenic driver BTF3L4 was a common target gene of miR-194 and miR-192. In GC, MIR194-2HG was downregulated, which further led to the reduced expression levels of miR-194 and miR-192. Meanwhile, the downregulation of miR-194/192 resulted in BTF3L4 overexpression, ultimately promoting the malignant progression of GC.

Fig. 8
figure 8

Hypothetical working model of MIR194-2HG in GC. Briefly, MIR194-2HG expression is clinically associated with favorable prognosis and plays tumor suppressive roles in GC. Mechanically, MIR194-2HG expression was transcriptionally induced by the hepatocyte nuclear factor HNF4A. Meanwhile, MIR194-2HG positively regulates the expression of its derived miR-194 and miR-192. The oncogene BTF3L4 has been confirmed to be a common target gene of miR-192 and miR-194. MIR194-2HG knockdown promotes GC progression by maintaining BTF3L4 overexpression through regulating microRNA biogenesis if miR-194/192

Full size image

Discussion

Increasing studies have shown that lncRNA dysregulation plays broad and complex roles in tumorigenesis and metastasis [9, 19,20,21]. LncRNA usually acts as signals, decoys, guides, and scaffolds to participate in diverse processes such as epigenetic modification, transcriptional regulation, protein translation, RNA/protein stability, and miRNA sponge, thereby exerting biological roles in diverse diseases [7, 9, 22]. As a special subclass of newly discovered lncRNAs derived from miRNA host genes, lncRNA MIRHG can exert its biological role in classical or non-classical modes. The classic mode refers to MIRHG acting as a classical lncRNA to perform functions such as miRNA sponge or RNA-protein interaction. The non-classical mode refers to that MIRHG plays a role in promoting its derived microRNA biogenesis.

For example, previous studies have confirmed that MIR22HG can exert biological functions in both classical and non-classical ways. Deng et al. have found that MIR22HG inhibits breast cancer progression by stabilizing the tumor suppressor gene LATS2 by sponging miR-629-5p [23]. Su and colleagues have reported that lncRNA MIR22HG functions as a tumor suppressor in lung cancer by binding and stabilizing YBX1 protein [24]. In addition to classic function, lncRNA MIR22HG also exerts non-classical function by regulating its derived miR-22 expression. Li et al. have shown that lncRNA MIR22HG promotes skeletal muscle differentiation and regeneration by inhibiting HDAC4 expression via upregulating miR-22-3p expression [25]. Jin and colleagues have found that MIR22HG promotes liver cancer cell radiosensitivity by targeting HDAC2 via enhancing miR-22 expression [26]. Similarly, Chou et al. have reported that MIR22HG repressed AP4 expression by encoding miR-22-3p [27].

As a MIRHG lncRNA, the biological function of MIR194HG has hardly been reported. There is only one study of MIR194-2HG which was reported by Xu and colleagues. They uncovered a classical function of MIR194-2HG: MIR194-2HG regulates liver cancer progression by sponging miR-1207-5p [28]. However, the biological role of MIR194-2HG in GC and whether it can function through non-classical functions have not been reported yet. In this study, we confirmed that MIR194-2HG plays tumor-suppressive roles in GC. Clinical analysis revealed that low expression of MIR194-2HG showed a significant correlation with the degree of malignancy and predicted poor prognosis in two independent GC cohorts. Loss-of-function studies indicated that MIR194-2HG depletion significantly accelerated GC cell proliferation and metastasis. More importantly, we found that MIR194-2HG inhibits GC progression by inducing the expression of miR-194 and miR-192.

We previously identified BTF3L4 as an oncogenic driver that is required for gastrointestinal tumor cell proliferation [16]. In this study, we further confirmed that BTF3L4 was a common target gene of both miR-194 and miR-192 in GC by RNA sequencing studies. Moreover, our finding highlighted that MIR194-2HG inhibited GC cell proliferation and invasion by repressing BTF3L4 expression via inducing miR-194 and miR-192. In addition, we further confirmed that MIR194-2HG and its derived miR-194 and miR-192 were transcriptionally induced by HNF4A. Notably, several independent studies have also reported that miR-194 and miR-192 were positively regulated by HNF1A and HNF4A [29,30,31,32]. Our research results are highly consistent with previous studies, suggesting that the regulation of miR-194 and miR-192 by HNF4A/HNF1A may be widely present in gastrointestinal tissues.

Conclusion

In summary, lncRNA MIR194-2HG and derived miR-194 and miR-192 were transcriptionally induced by HNF4A. The oncogenic driver BTF3L4 is identified as a common target gene of miR-194 and miR-192. Our finding highlights that MIR194-2HG inhibits GC progression by activating the expression of miR-192 and miR-194 and repressing BTF3L4 expression.

Materials and methods

Clinical GC samples

The study protocol was approved by the Human Research Ethics Committee of Hubei University of Medicine. The procedures are in accordance with the Helsinki Decaration of 1975. Written informed consent was obtained from all patients. Tissue samples (n = 42) were immediately frozen in liquid nitrogen after resection and stored at − 80 °C until use. All samples were pathologically confirmed.

Microarray data analysis of GSE62254 and pan-cancer analysis in TCGA

The gene expression data in GSE62254 was downloaded from the NCBI web server. The clinical information of GC patients in GSE62254 cohort was downloaded as we described previously [33, 34]. The RNA-Seq data of 407 gastric cancer samples and the correlated clinical information of 443 gastric cancer samples were downloaded from the Cancer Genome Atlas (TCGA). The expression level of each gene was calculated from the log2 of its upper quartile FPKM (FPKM-UQ) value.

Cell transfection and establishment of cell lines

Human gastric cancer cell lines were purchased from GeneChem (Shanghai, China). The lentiviruses for knockdown of MIR194-2HG in GC cell lines were purchased from GeneChem (Shanghai, China). GC cells were cultured at 37ËšC as usual. At the indicated time points, the cells were harvested for mRNA and protein analysis as well as for other assays.

RNA sequencing

The total RNA in GC cells was extracted to perform RNA sequencing (RNA-seq). A total of 1.5 µg RNA per sample was used as input material for the RNA sample preparations. The whole process of library construction and sequencing was performed at Shanghai Lifegenes Technology Co., Ltd. The RNA-seq data used in this study was uploaded in Table S1 or in GEO database. The GEO accession number is GSE183538.

Northern blot

Total RNA (20–40 ug) was extracted from GC cells using Trizol reagent (Invitrogen, USA). Northern blots were performed using biotin-labeled probes. Briefly, total RNA samples were run on 15% PAGE urea gels and transferred to Hybond-N + positively charged nylon membranes (GE healthcare, USA) by electrophoresis. Next, the membranes were further UV-crosslinked and dried at 60 °C for 1 h. Before hybridization, the membranes were pre-hybridized at 40 °C for 1 h using pre-hybridization buffer (#AM8677, Thermo Scientific). Then, add a hybridization buffer containing 50 pmol/ml biotin-labeled single-stranded DNA oligonucleotides and gently shake the membrane at 40 °C to hybridize overnight. The bands were quantified using the ImageJ software.

Subcellular location of lncRNA

The RNA FISH assay was conducted as previously described [21, 35]. For the RNA FISH assay, the 5’FAM-MIR194-2HG probes were designed and synthesized by Sangon Biotech (Shanghai). After incubation and hybridization, images were taken with a confocal microscope (Zeiss).

Xenograft tumorigenic assay

The study protocol was approved by the Experimental Animal Research Ethics Committee of Hubei University of Medicine. All animals were treated in accordance with the guidelines of the Committee on Animals of the Hubei University of Medicine. The four-week-old female Balb/C-nude mice were purchased from Beijing Weitonglihua Experimental Animal Co., LTD and Jiangsu Jicuiya okang BioteChinaology Co., LTD, and reared in SPF environmental cages. The mice were randomly divided into groups, with 5 mice in each group (100ul, 1 × 106 cells per/animal) were inoculated into the left back subcutaneously of mice. The tumor tissues were observable on the sixth day after inoculation. Then the tumor size and weight of mice were measured every three days. The tumor tissues were collected and recorded by photography. Tumor volumes were calculated according to the formula A × B2/2 (A = maximum diameter; B = minimum diameter) (mm3).

RNA isolation and quantitative RT-PCR

The qPCR protocol using One Step TB Green PrimeScript™ RT-PCR Kit II (Takara) is according to the manufacturer’s instructions. The qPCR analysis was conducted on Bio-Rad CFX Manager 3.1 real-time PCR system. All the primers were synthesized by Wcgene Biotech (Shanghai, China). RNU6B (U6) and ACTB were used as internal controls. Each gene was run in triplicate. Relative fold changes of gene expression were calculated using the comparative ΔΔCt method. The primers used in this study are listed below. BTF3L4-qF, CCGAAGCTCATGGTTCTAGG; BTF3L4-qR AGCTGGCTCCTGTGTAATGG; HNF4A-qF, CAGATGATCGAGCAGATCCA; HNF4A-qR TCCCATATGTTCCTGCATCA; MIR194-2HG-qF: AAATGCCTGCTGGGTCTCT, MIR194-2HG-qR: GGGACCCTTGGGTCTCTCT; miR-192-qF: GGGCTGACCTATGAATTGAC; miR-194-qF: GGGTGTAACAGCAACTCCAT; miRNA-universe-qR: CAGTGCGTGTCGTGGAGT. Universe RT primer of miR-192: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGGCTGTC; Universe RT primer of miR-194: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCCACAT; U6 RT primer: AACGCTTCACGAATTTGCGT; U6qF: CTCGCTTCGGCAGCACA, U6qR: AACGCTTCACGAATTTGCGT. ACTB_qF: ATCGTCCACCGCAAATGCTTCTA, ACTB_qR: AGCCATGCCAATCTCATCTTGTT.

MicroRNA PCR array

GC cells were transfected with siRNAs targeting HNF4A and the corresponding negative control siRNA for 48 h. Then, the total RNA was extracted and reverse-transcribed to obtain cDNA using the PrimeScript™ RT reagent Kit (Perfect Real Time, Takara). The cDNA samples were sent to the Wcgene Biotech (Shanghai, China) company on dry ice to perform a microRNA PCR assay. Relative fold changes of miRNA expression were calculated using the comparative ΔΔCt method. A minimum of triplicates per group was applied to achieve reproducibility.

Western blot assay

Gastric cancer cells were lysed in RIPA buffer added with 1 mM PMSF. Approximately 100 µg of total protein was electrophoresed through 10% SDS polyacrylamide gels and were then transferred to a PVDF membrane. After blocking with 5% skimmed milk at 4 °C for 1 h, the membrane was incubated with primary antibody at 4 °C overnight. The blots then washed and incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (1: 10000, Earthox) for 1.5 h at room temperature. Detection was performed using a SuperLumia ECL HRP Substrate Kit (Abbkine) and visualized using a Bio-Rad Imaging System (USA). The antibodies used in this study are listed as follows: BTF3L4 (Proteintech, 16500-1-AP), HNF4A (Santa Cruz, sc-374229), β-Actin (Proteintech, 20536-1-AP).

Chromatin immunoprecipitation assay

Chromatin immunoprecipitation (CHIP) assays were performed using the CHIP Assay Kit (56383 S, Cell Signal Technology, USA) according to the manufacturer’s protocol. Briefly, GC cell line AGS were collected and fixed for 10 min at 37 with 1% formaldehyde, followed in sequence with SDS lysis and DNA shearing, protein and DNA immunoprecipitation, cross-linked DNA reversal, and DNA purification, and finally the immunoprecipitated DNA fragments were detected by PCR assays. The normal rabbit IgG was used as the negative control. The HNF4A antibody (cat no. sc-374229) used in the Chip assay was purchased from Santa Cruz Biotechnology, Inc. (USA).

Flow cytometry assay

After 48 h transfection with siRNAs and corresponding negative control siRNAs, GC cells were collected to perform cell cycle assay and cell apoptosis assay in accordance with the manufacture’s protocol (BB-4104, BestBio, China). Flow cytometry assays were performed on the CytoFLEX machine (Beckman, USA). The cell cycle distribution was quantified using the CytExpert software.

Statistical analysis

For gene expression analysis in subtypes of GC, the P values were estimated using the Mann–Whitney nonparametric test. Survival curves were calculated using the Kaplan–Meier method, and differences between the curves were analyzed using the log-rank test. All the rest of the experiments used unpaired t-tests or one-way ANOVA tests. For all experiments, a minimum of triplicates per group and repetition of at least three times was applied to achieve reproducibility. All tests with p-values less than 0.05 are considered statistically significant.

Data availability

Data is provided within the manuscript or supplementary information files.

Abbreviations

GC:

Gastric cancer

TCGA:

The Cancer Genome Atlas

MIRHG:

MicroRNA host gene

CHIP:

Chromatin immunoprecipitation

lncRNA:

Long non-coding RNA

TPM:

Transcripts per million

qRT-PCR:

Quantitative reverse transcription Polymerase Chain Reaction

GEO:

Gene Expression Omnibus

FPKM:

Fragments Per Kilobase of exon model per Million mapped fragments

STAD:

Stomach adenocarcinoma

HNF4A:

Hepatocyte nuclear factor 4α

References

  1. Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. CA Cancer J Clin. 2024;74(1):12–49.

    Article  Google Scholar 

  2. Bray F, Laversanne M, Sung H, Ferlay J, Siegel RL, Soerjomataram I, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229–63.

    Article  PubMed  Google Scholar 

  3. Sun D, Cao M, Li H, He S, Chen W. Cancer burden and trends in China: a review and comparison with Japan and South Korea. Chin J Cancer Res. 2020;32(2):129–39.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Li D, Xia L, Huang P, Wang Z, Guo Q, Huang C, et al. Cancer-associated fibroblast-secreted IGFBP7 promotes gastric cancer by enhancing tumor associated macrophage infiltration via FGF2/FGFR1/PI3K/AKT axis. Cell Death Discovery. 2023;9(1):17.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  5. Xia JY, Aadam AA. Advances in screening and detection of gastric cancer. J Surg Oncol. 2022;125(7):1104–9.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Li D, Huang P, Xia L, Leng W, Qin S. Cancer-associated fibroblasts promote gastric cancer cell proliferation by paracrine FGF2-driven ribosome biogenesis. Int Immunopharmacol. 2024;131:111836.

    Article  PubMed  CAS  Google Scholar 

  7. Qin S, Liu Y, Zhang X, Huang P, Xia L, Leng W, et al. lncRNA FGD5-AS1 is required for gastric cancer proliferation by inhibiting cell senescence and ROS production via stabilizing YBX1. J Experimental Clin cancer Research: CR. 2024;43(1):188.

    Article  PubMed Central  CAS  Google Scholar 

  8. Qin S, Guo Q, Liu Y, Zhang X, Huang P, Yu H, et al. A novel TGFbeta/TGILR axis mediates crosstalk between cancer-associated fibroblasts and tumor cells to drive gastric cancer progression. Cell Death Dis. 2024;15(5):368.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  9. Li D, Shen L, Zhang X, Chen Z, Huang P, Huang C, et al. LncRNA ELF3-AS1 inhibits gastric cancer by forming a negative feedback loop with SNAI2 and regulates ELF3 mRNA stability via interacting with ILF2/ILF3 complex. J Experimental Clin cancer Research: CR. 2022;41(1):332.

    Article  PubMed Central  CAS  Google Scholar 

  10. Liu H, Li D, Sun L, Qin H, Fan A, Meng L, et al. Interaction of lncRNA MIR100HG with hnRNPA2B1 facilitates m(6)A-dependent stabilization of TCF7L2 mRNA and colorectal cancer progression. Mol Cancer. 2022;21(1):74.

    Article  PubMed  PubMed Central  Google Scholar 

  11. Sun Q, Song YJ, Prasanth KV. One locus with two roles: microRNA-independent functions of microRNA-host-gene locus-encoded long noncoding RNAs. Wiley Interdiscip Rev RNA. 2021;12(3):e1625.

    Article  PubMed  CAS  Google Scholar 

  12. Kim YK, Kim VN. Processing of intronic microRNAs. Embo J. 2007;26(3):775–83.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  13. Lu Y, Zhao X, Liu Q, Li C, Graves-Deal R, Cao Z, et al. lncRNA MIR100HG-derived miR-100 and miR-125b mediate cetuximab resistance via Wnt/beta-catenin signaling. Nat Med. 2017;23(11):1331–41.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  14. Yuan G, Liu B, Han W, Zhao D. LncRNA-MIR17HG mediated upregulation of miR-17 and miR-18a promotes colon cancer progression via activating Wnt/beta-catenin signaling. Transl Cancer Res. 2019;8(4):1097–108.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  15. Wang J, Zhang M, Hu X, She J, Sun R, Qin S, et al. miRNA-194 predicts favorable prognosis in gastric cancer and inhibits gastric cancer cell growth by targeting CCND1. FEBS open bio. 2021;11(7):1814–26.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  16. Huang P, Xia L, Guo Q, Huang C, Wang Z, Huang Y, et al. Genome-wide association studies identify miRNA-194 as a prognostic biomarker for gastrointestinal cancer by targeting ATP6V1F, PPP1R14B, BTF3L4 and SLC7A5. Front Oncol. 2022;12:1025594.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  17. Chiang Y, Zhou X, Wang Z, Song Y, Liu Z, Zhao F, et al. Expression levels of microRNA-192 and – 215 in gastric carcinoma. Pathol Oncol Res. 2012;18(3):585–91.

    Article  PubMed  CAS  Google Scholar 

  18. Chen LL. Linking long noncoding RNA localization and function. Trends Biochem Sci. 2016;41(9):761–72.

    Article  PubMed  CAS  Google Scholar 

  19. Li DD, Xu MJ, Wang ZD, Huang P, Huang CC, Chen Z et al. The EMT-induced lncRNA NR2F1-AS1 positively modulates NR2F1 expression and drives gastric cancer via miR-29a-3p/VAMP7 axis. Cell Death Dis. 2022;13(1).

  20. Li DD, Wang JJ, Zhang MX, Hu XH, She JJ, Qiu XM, et al. LncRNA MAGI2-AS3 is regulated by BRD4 and promotes gastric Cancer Progression via maintaining ZEB1 overexpression by sponging miR-141/200a. Mol Ther-Nucl Acids. 2020;19:109–23.

    Article  Google Scholar 

  21. Li DD, She JJ, Hu XH, Zhang MX, Sun RN, Qin SS. The ELF3-regulated lncRNA UBE2CP3 is over-stabilized by RNA-RNA interactions and drives gastric cancer metastasis via miR-138-5p/ITGA2 axis. Oncogene. 2021;40(35):5403–15.

  22. Ming H, Li B, Zhou L, Goel A, Huang C. Long non-coding RNAs and cancer metastasis: molecular basis and therapeutic implications. Biochim Biophys Acta Rev Cancer. 2021;1875(2):188519.

    Article  PubMed  CAS  Google Scholar 

  23. Deng X, Ye D, Hua K, Song H, Luo Q, Munankarmy A, et al. MIR22HG inhibits breast cancer progression by stabilizing LATS2 tumor suppressor. Cell Death Dis. 2021;12(9):810.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  24. Su W, Feng S, Chen X, Yang X, Mao R, Guo C, et al. Silencing of long noncoding RNA MIR22HG triggers cell Survival/Death signaling via oncogenes YBX1, MET, and p21 in Lung Cancer. Cancer Res. 2018;78(12):3207–19.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  25. Li R, Li B, Cao Y, Li W, Dai W, Zhang L, et al. Long non-coding RNA Mir22hg-derived mir-22-3p promotes skeletal muscle differentiation and regeneration by inhibiting HDAC4. Mol Ther Nucleic Acids. 2021;24:200–11.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  26. Jin Q, Hu H, Yan S, Jin L, Pan Y, Li X, et al. lncRNA MIR22HG-Derived Mir-22-5p enhances the radiosensitivity of Hepatocellular Carcinoma by increasing histone Acetylation through the inhibition of HDAC2 activity. Front Oncol. 2021;11:572585.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  27. Chou J, Kaller M, Jaeckel S, Rokavec M, Hermeking H. AP4 suppresses DNA damage, chromosomal instability and senescence via inducing MDC1/Mediator of DNA damage checkpoint 1 and repressing MIR22HG/miR-22-3p. Mol Cancer. 2022;21(1):120.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  28. Xu G, Zhu Y, Liu H, Liu Y, Zhang X. LncRNA MIR194-2HG promotes cell proliferation and metastasis via regulation of miR-1207-5p/TCF19/Wnt/beta-Catenin signaling in Liver Cancer. Onco Targets Ther. 2020;13:9887–99.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  29. Bao C, Li Y, Huan L, Zhang Y, Zhao F, Wang Q, et al. NF-kappaB signaling relieves negative regulation by miR-194 in hepatocellular carcinoma by suppressing the transcription factor HNF-1alpha. Sci Signal. 2015;8(387):ra75.

    Article  PubMed  Google Scholar 

  30. Hino K, Tsuchiya K, Fukao T, Kiga K, Okamoto R, Kanai T, et al. Inducible expression of microRNA-194 is regulated by HNF-1 alpha during intestinal epithelial cell differentiation. RNA. 2008;14(7):1433–42.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  31. Morimoto A, Kannari M, Tsuchida Y, Sasaki S, Saito C, Matsuta T, et al. An HNF4alpha-microRNA-194/192 signaling axis maintains hepatic cell function. J Biol Chem. 2017;292(25):10574–85.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  32. Lu H, Lei X, Liu J, Klaassen C. Regulation of hepatic microRNA expression by hepatocyte nuclear factor 4 alpha. World J Hepatol. 2017;9(4):191–208.

    Article  PubMed  PubMed Central  Google Scholar 

  33. Li DD, Cheng P, Wang JJ, Qiu XM, Zhang XD, Xu L et al. IRF6 is directly regulated by ZEB1 and ELF3, and predicts a favorable prognosis in gastric Cancer. Front Oncol. 2019;9.

  34. Li D, Xia L, Zhang X, Liu Y, Wang Z, Guo Q, et al. A new high-throughput screening methodology for the discovery of cancer-testis antigen using multi-omics data. Comput Methods Programs Biomed. 2024;250:108193.

    Article  PubMed  Google Scholar 

  35. Li D, Xia L, Huang P, Wang Z, Guo Q, Huang C, et al. Heterogeneity and plasticity of epithelial-mesenchymal transition (EMT) in cancer metastasis: focusing on partial EMT and regulatory mechanisms. Cell Prolif. 2023;56(6):e13423.

Download references

Acknowledgements

We are very grateful to Dr. Jiwei Li (Lifegenes Biotechnology, Shanghai, China) for contributing to the RNA-Seq analysis.

Funding

This work was supported by the National Natural Science Foundation of China (82203829, 82273451); the Natural Science Foundation of Hubei Province (2022CFB448 and 2022CFB911).

Author information

Authors and Affiliations

  1. Department of Orthopaedic Surgery, Renmin Hospital, Hubei University of Medicine, Shiyan, China

    Hong Cao & Dandan Li

  2. Hubei Key Laboratory of Embryonic Stem Cell Research, School of Basic Medical Sciences, Hubei University of Medicine, Shiyan, Hubei, 442000, China

    Zidi Wang, Qiwei Guo, Shanshan Qin & Dandan Li

  3. Laboratory of Tumor Biology, Academy of Bio-Medicine Research, Hubei University of Medicine, Shiyan, Hubei, P.R. China

    Shanshan Qin & Dandan Li

  4. Shiyan Key Laboratory of Natural Medicine Nanoformulation Research, Hubei University of Medicine, Shiyan, Hubei, 442000, China

    Shanshan Qin & Dandan Li

Authors
  1. Hong Cao
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Zidi Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Qiwei Guo
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Shanshan Qin
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Dandan Li
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

LD, CH, and QS conceived and designed the study. QS and LD wrote the paper. CH, WZ and GQ performed most of the experiments. WZ, GQ, and CH carried out initial data analyses and performed part of the experiments. All authors contributed to drafting the manuscript. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Shanshan Qin or Dandan Li.

Ethics declarations

Ethics approval and consent to participate

The study is approved by the Ethics Committee of Hubei University of Medicine (2021-028).

Consent for publication

All authors agreed on the manuscript.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Cao, H., Wang, Z., Guo, Q. et al. MIR194-2HG, a miRNA host gene activated by HNF4A, inhibits gastric cancer by regulating microRNA biogenesis. Biol Direct 19, 95 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13062-024-00549-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13062-024-00549-z

Keywords

Biology Direct

ISSN: 1745-6150

Contact us