Skip to main content
Download PDF

ALKBH5 activates CEP55 transcription through m6A demethylation in FOXP2 mRNA and expedites cell cycle entry and EMT in ovarian cancer

Biology Direct volume 19, Article number: 105 (2024) Cite this article

Abstract

Background

Centrosomal protein of 55 kDa (CEP55) overexpression has been linked to tumor stage, aggressiveness of the tumor, poor prognosis, and metastasis. This study aims to elucidate the action of CEP55 in ovarian cancer (OC) and the regulation by the alpha-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5)/Forkhead box protein P2 (FOXP2) axis.

Methods

Differentially expressed genes in OC were identified using in silico identification, followed by prognostic value assessment. Lentiviral vectors were constructed to downregulate CEP55 in OC cells, and colony formation, EdU, TUNEL, flow cytometry, Transwell assays, and Phalloidin staining were conducted. Transcription factors regulating CEP55 were predicted and verified, and rescue experiments were performed. The effect of ALKBH5-mediated demethylation on FOXP2 mRNA stability and OC cell cycle and EMT were analyzed.

Results

High expression of CEP55 in OC was linked to unsatisfactory prognosis of patients. Knockdown of CEP55 repressed proliferation, invasiveness, and epithelial-mesenchymal transition (EMT) while inducing apoptosis and cell cycle arrest in OC cells. FOXP2 bound to the promoter of CEP55 to repress CEP55 transcription. FOXP2 regulated transcriptional repression of CEP55 to impede the malignant progression of OC and inhibit tumor metastasis. ALKBH5-mediated demethylation modification induced mRNA degradation of FOXP2. Knockdown of ALKBH5 induced cell cycle arrest and inhibited EMT in OC cells.

Conclusions

ALKBH5 hinders FOXP2-mediated transcriptional repression of CEP55 to promote the malignant progression of OC via cell cycle and EMT.

Background

Among the malignancies affecting the female reproductive tract, that of the ovary is the most frequently fatal [1]. Ovarian cancer (OC) is frequently epithelial in origin and mainly treated with surgery and cytoreduction followed by cytotoxic platinum and taxane chemotherapy, and recurrence is likely to occur within a median of 16 months for patients with advanced-stage disease [2]. Therefore, novel treatment strategies separate from traditional chemotherapy that take advantage of advances in understanding the pathophysiology of OC are needed to improve patient outcomes.

Centrosomal protein of 55 kDa (CEP55), also termed c10orf3 and FLJ10540, was initially discovered as a mitotic phosphoprotein that moves from centrosome to midbody during the later stages of mitosis and has been linked to tumor stage, aggressiveness of tumor, poor prognosis as well as metastasis [3]. Even though it has been recently identified as one of the potential biomarkers and ten hub genes in OC [4], the specific role of CEP55 in OC needs to be further explored. Epithelial-to-mesenchymal transition (EMT) is a reversible process in which epithelial cells lose their apical-basal polarity and cell-cell adhesion to become more spindle-shaped mesenchymal cells with increased migratory capacity, during which E-cadherin is repressed, while Vimentin and neural cadherin (N-cadherin) are upregulated [5]. CEP55 knockdown has been reported to suppress EMT, which was controlled via upregulation of E-cadherin and downregulation of N-cadherin and Zinc finger E-box-binding homeobox 1 (ZEB1) in renal cell carcinoma [6]. Additionally, CEP55 silencing induced cell cycle arrest at the G0/G1 phase and cell apoptosis in breast cancer cells [7].

Furthermore, the overexpression of CEP55 in human hepatocellular carcinoma tissues was linked to poor overall survival and cancer recurrence, and its transcription was induced by a complex consisting of TEA domain transcription factors, forkhead box (FOX) M1, and yes-associated protein [8]. Therefore, we postulated that the oncogenic role of CEP55 in OC was related to the upstream transcription factors. FOX protein P2 (FOXP2) was thus identified as the modifier that represses the CEP55 transcription in the present study. FOXP2 mainly controls language development, while recent evidence showed its role as a tumor suppressor in cancer progression [9]. N6-methyladenosine (m6A), a posttranscriptional modification in RNA, is dynamical and reversible, and aberrant levels of m6A and its regulators, have been implicated in tumorigenesis, metastasis, as well as resistance in OC [10]. In the present study, FOXP2 downregulation in OC was controlled by reduced m6A modification and the overexpression of RNA demethylase alpha-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5) in OC. In the study here, we display that the knockdown of CEP55 in OC cells is beneficial to hindering tumor growth and metastasis, in part through regulation of the cell cycle and EMT. We also demonstrate that the expression of CEP55 in OC cells is regulated by FOXP2 and the expression of FOXP2 by ALKBH5. As such, CEP55 might represent a potential therapeutic target for OC.

Methods

Patient tissue samples

Nineteen pairs of OC and adjacent normal tissue were obtained from patients who underwent radical oophorectomy in Taizhou Hospital, Zhejiang Province from 2017 to 2019. None of the patients received prior chemotherapy, radiotherapy, or targeted therapy. The patients were followed up at 6-month intervals after surgery for 60 months. All cases were diagnosed by an independent pathologist (14 cases of high-grade serous, 2 cases of endometrioid OC, 2 cases of clear cell OC, and 1 case of mucinous OC). Lymph node metastases in patients were identified by systematic lymph node dissection, and distal metastases were assessed by PET/CT or MRI. The current study was approved by the Ethics Review Committee of Taizhou Hospital, Zhejiang Province and performed following the Declaration of Helsinki. All participants signed informed consent documentation.

Cell culture and infection

Human OC cell lines A2780 (CL-0013) and SKOV3 (CL-0215) were procured from Procell (Wuhan, Hubei, China) and cultured in RPMI-1640 medium containing 10% FBS and 1% penicillin/streptomycin in an incubator containing 5% CO2 at 37 °C.

The lentiviruses used to overexpress FOXP2, overexpress CEP55, knockdown CEP55, and knockdown ALKBH5 were constructed by VectorBuilder (Guangzhou, Guangdong, China). In 6-well plates, A2780 and SKOV3 cells were cultured until a 50% confluence and infected with lentiviral vectors, with 5 µg/mL polybrene added to increase infection efficiency. The cells were refreshed 24 h after infection, and positive cells were screened with puromycin (0.5 µg/mL) for 2 weeks to produce stably infected cells. The shRNA sequences are shown as follows: hCEP55[shRNA 1#]: AAGTGGGGATCGAAGCCTAGTAACTCCAAATCCGAAACTAC; hCEP55[shRNA 2#]: AGATAGCTCAGGTTATTGCTAATGGGTTAATGCACCAGCAA; hCEP55[shRNA 3#]: TGTATGATCAGCAGCGGGAAGTCTATGTAAAAGGACTTTTA; hALKBH5[shRNA 1#]: CTCCTGGATGGAAAGGCTGTTGGCATCAATAGGGGACAGAG; hALKBH5[shRNA 2#]: CAGTCATCATCCTCAGGAAGACAAGATTAGATGCACCCCGG; hALKBH5[shRNA 3#]: ATATGCTGCTGATGAAATCACTCACTGCATACGGCCTCAGG.

Colony formation assay

The treated A2780 and SKOV3 cells were plated into six-well plates and cultured for 2 weeks to obtain cell colonies. Next, the cell colonies were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet for 30 min, and the colony formation was counted under a light microscope.

EdU proliferation assay

Click-iT EdU Cell Proliferation Imaging Kit with Alexa Fluor 488 Dye (C10337, Thermo Fisher Scientific Inc., Waltham, MA, USA) was used. After first labeling with EdU, the cells were fixed using 4% paraformaldehyde for 15 min and incubated with 0.5% Triton X-100 for 20 min and with a Click-iT reaction cocktail for 0.5 h in the dark (both at room temperature). The nuclei were labeled using DAPI, and the cells were viewed under a fluorescence microscope. The percentage of EdU-positive cells was measured.

TUNEL assay

TUNEL Apoptosis Assay Kit (E607172, Shanghai Sangon Biological Engineering Technology & Services Co., Ltd., Shanghai, China) was used to assess apoptosis. The treated A2780 and SKOV3 cells were treated with TUNEL working solution at 37 °C for 1 h. At the end of the reaction, the cells were washed, added with reaction buffer, and fixed with 4% paraformaldehyde. After washing, nuclei were labeled using DAPI, and the cells were observed under a fluorescence microscope. The percentage of TUNEL-positive cells was calculated.

Flow cytometry

Treated A2780 and SKOV3 cells (1 × 106) were collected for centrifugation and washing. The cells were fixed with 75% cold ethanol at -20 °C for 24 h. Next, the fixed cells were treated at RM with 500 µL of propidium oxide staining solution for 15 min in the dark, and loaded to analyze the cell cycle.

Transwell assay

For cell migration, a 24-well Transwell plate with an 8 μm pore size was used to perform the procedure. Treated A2780 and SKOV3 cells (5 × 104) were seeded in the apical chamber, and serum-free medium was added to exclude cell proliferation, while the basolateral chamber was loaded with fresh medium containing 10% FBS. After incubation at 37 °C for 24 h, the cells in the basolateral chamber were fixed in paraformaldehyde and stained with crystal violet, and the number of migrated cells was counted.

In the invasion assay, 5 × 104 cells were plated into the Matrigel-coated apical chamber. The reminding steps were the same as the migration assay.

Phalloidin staining

The treated A2780 and SKOV3 cells were plated in 96-well plates, grown to confluence, fixed using 4% paraformaldehyde for 15 min at RM, permeabilized by 0.1% Triton X-100 for 5 min, and incubated with Phalloidin-iFluor 488 (ab176753, Abcam, Cambridge, MA, USA) for 1 h at RM. After the nuclei were stained with DAPI, the alteration of the cytoskeleton was viewed under a fluorescence microscope.

ChIP

We used SimpleChIP Enzymatic ChIP Kit (Magnetic Beads) (9003, Cell Signaling Technologies (CST), Beverly, MA, USA) according to the kit instructions. Firstly, treated A2780 and SKOV3 cells were incubated with 37% formaldehyde for 10 min and with glycine for 5 min (at RM). The cells were washed after removing the medium, centrifuged at 2,000 g for 5 min at 4 °C, resuspended in buffer A + DTT + PIC, and the incubation was carried out for 10 min. The cells were centrifuged at 2000 g for 5 min at 4 °C, and the precipitate was dissolved in ice-cold buffer B + DTT, followed by incubation with Micrococcal Nuclease at 37 °C for 20 min. The detachment was terminated using EDTA, and the cells were centrifuged at 16,000 g for 1 min at 4 °C. The supernatant was removed, and the precipitate was resuspended and incubated with ChIP buffer + PIC in ice for 10 min, followed by lysis of the nuclei by ultrasonic fragmentation. Afterward, the fragmented product was centrifuged at 9400 g for 10 min at 4 °C, and the supernatant was incubated overnight at 4 °C with anti-FOXP2 (1:200, 5337, CST) or control anti-IgG (1:200, 2729, CST). The IP reaction mixture was incubated with protein G magnetic beads at 4 °C for 2 h. After the separation of protein G magnetic beads, the samples were incubated with ChIP elution buffer at 65 °C for 30 min. The chromatin supernatant was incubated with NaCl and proteinase K at 65 °C for 120 min for de-crosslinking. The relative enrichment of the CEP55 promoter fragment in the DNA was quantified by PCR after isolation of the DNA using a DNA purification centrifuge column.

Luciferase reporter assay

We inserted the CEP55 promoter fragment and the promoter fragment mutated with FOXP2 binding site into luciferase reporter vectors, and FOXP2 cDNA with CDS sequence was inserted into luciferase reporter vector. Subsequently, the luciferase reporter plasmid was transfected into A2780 and SKOV3 cells overexpressing FOXP2 to construct the wild-type and mutant cells using Lipofectamine 2000. Alternatively. luciferase reporter plasmid with CDS sequence was transfected into A2780 and SKOV3 cells with sh-ALKBH5. After 48-h culture, the transcriptional regulation between FOXP2 on CEP55 and the effect of knockdown of ALKBH5 on the stability of FOXP2 was evaluated by analyzing the luciferase activity through the Dual-Luciferase Reporter Assay System (E1910, Promega Corporation, Madison, WI, USA).

RIP

The Magna RIP Kit (17–700, Sigma-Aldrich, St Louis, MO, USA). According to the kit instructions, A2780 and SKOV3 cells were incubated with RIP lysis buffer for 5 min on ice, and the lysates were centrifuged at 5000 g for 10 min at 4 °C to remove the supernatant. After the addition of immunoprecipitation buffer, the cells were incubated with magnetic beads coupled with antibodies against ALKBH5 (1:200, ABE547, Sigma-Aldrich) or IgG (1:200, 2729, CST) overnight at 4 °C. The immunoprecipitates were centrifuged and placed on a magnetic separator to remove the supernatant, which was repeated five times. The immunoprecipitates were suspended in proteinase K buffer and incubated with 10% SDS and proteinase K for 30 min at 55 °C to digest the proteins. After centrifugation, the magnetic beads were separated using a magnetic separator, and the supernatant fractions were washed with RIP wash buffer. After separating the precipitated RNAs using phenol/chloroform/isoamyl alcohol, the RNA enrichment in which FOXP2 was present was analyzed by RT-qPCR assay.

MeRIP-qPCR

According to the instructions for EpiQuik CUT&RUN m6A RNA Enrichment (MeRIP) Kit (P-9018-24, Epigentek Group Inc., Farmingdale, NY, USA), TRIZol reagent was used to extract the total RNA and stored at -80 °C. The RNA sample was incubated with an Immunocapture solution for 90 min and with a nuclear digestion enhancer and cleavage enzyme mix for 5 min at RM. The beads were separated using a magnetic separator and incubated with Protein Digestion Solution for 15 min at 55℃. The magnetic beads were separated using a magnetic separator, and the supernatant was incubated with an RNA purification solution containing RNA and RNA binding beads at RM for 5 min to induce RNA binding to the beads. The magnetic beads were separated using a magnetic separator and washed with ethanol. Next, the magnetic beads were incubated with elution buffer for 5 min at RM, and the supernatant RNA fraction was collected after the separation of the beads using a magnetic separator. Finally, the enrichment of FOXP2 in RNA fractions was analyzed by RT-qPCR to evaluate the alteration of its m6A modification.

RNA stability assay

Treated A2780 and SKOV3 cells were seeded in 6-well plates and treated with actinomycin D (5 µg/mL, HY-17559, MedChemExpress, Monmouth Junction, NJ, USA) for 0, 2, 4, and 6 h, respectively. The total RNA was isolated, and quantitative analysis of the mRNA of FOXP2 was performed by RT-qPCR.

In vivo experiments

All animal-related procedures were permitted by the Institutional Animal Care and Use Committee of Taizhou Hospital, Zhejiang Province. Female BALB/c nude mice (6-8-week-old) were procured from Vital River (Beijing, China). Twenty-four nude mice were randomly divided into 4 groups (n = 6/group). We constructed a xenograft tumor model by intraperitoneal injection of 2 × 106 SKOV3 cells with LV-NC-OE, LV-FOXP2-OE, LV-FOXP2-OE + NC-OE, LV-FOXP2-OE + CEP55-OE. After 6 weeks, the mice were euthanized by sodium pentobarbital (i.p.). The abdominal cavity of the mice was opened, and the abdominal tumors were photographed and weighed to make paraffin sections. In addition, the number of metastatic tumor foci in lung tissues was analyzed by hematoxylin-eosin (HE) staining after collecting all mouse lung tissues for paraffin sections.

Immunohistochemical staining

Paraffin-embedded sections of tumor samples were deparaffinized, rehydrated, and subjected to antigen retrieval to block endogenous peroxidase activity and to remove non-specific binding sites. The sections were incubated with anti-ALKBH5 (1:2000, ab195377, Abcam) at 4 °C overnight and with HRP-coupled secondary antibody (1:5000, 31460, Thermo Fisher) for 2 h at RM. DAB was used for color development, and the nuclei were counter-stained with hematoxylin. After ethanol dehydration and xylene clearing, the sections were sealed with neutral gum and observed for section positivity.

HE staining

For the analysis of the number of tumor metastatic lesions in mouse lung tissues, paraffin-embedded sections of mouse lung tissues were subjected to xylene dewaxing and ethanol rehydration, followed by incubation with hematoxylin for 10 min at RM. The sections were treated with 1% hydrochloric acid-ethanol for 15 s, returned to blue for 1 min, washed with 95% ethanol, and counter-stained with eosin stain for 1 min. After ethanol dehydration and xylene clearing, the sections were sealed with neutral gum, and the number of foci in the lung tissue was observed and counted.

RNA extraction and RT-qPCR

Total RNA from OC cells and tumor tissues was isolated using TRIzol reagent, and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix (FSQ-201, Toyobo, Shanghai, China). Next, qPCR was performed using THUNDERBIRD Next SYBR qPCR Mix (QPX-201, Toyobo). β-actin was used as the reference gene for normalization. PCR products were assessed by melting curve analysis. Relative mRNA levels were calculated by the 2−ΔΔCt method. Table 1 lists the sequences of the primers used in PCR.

Table 1 Primers used for qPCR assay
Full size table

Western blot analyses

Total proteins were extracted from OC cells and tumor tissue using RIPA buffer, and the protein concentration in each extract was assessed using a BCA assay kit. The protein samples were denatured in a water bath, followed by separation with 10% SDS-PAGE and blotting onto PVDF membranes. The membranes were sealed with 5% skimmed milk powder for 2 h and incubated with primary antibodies, including P21 (1:1000, ab109199, Abcam), Cyclin D1 (1:20, ab16663, Abcam), E-cadherin (1:1000, A3044, ABclonal, Wuhan, Hubei, China), Vimentin (1:1000, ab92547, Abcam), Snail (1:500, A5243, ABclonal), ZEB1 (1:500, 21544-1-AP, ProteinTech Group, Chicago, IL, USA), Slug (1:5000, 12129-1-AP, ProteinTech Group), N-cadherin (1:5000, ab76011, Abcam), and β-actin (1:1000, ab8227, Abcam). Membranes were incubated with HRP-labeled secondary antibody (1:10,000, 31460, Thermo Fisher) at RM for 2 h. Finally, the target proteins were visualized using an enhanced chemiluminescence kit, and the gray values of the representative bands were analyzed by Image J analysis.

Statistical analyses

The normal distribution test was conducted using Shapiro-Wilk, and all data are presented as the mean and SD. Paired t-test was used to examine differences between groups. GraphPad Prism 8.0.2 (GraphPad, San Diego, CA, USA) was used to prepare graphical presentations. Statistical analysis for data included a paired t-test for paired data comparison between two groups, and ANOVA with Tukey’s or Sidak’s test for data comparison between multiple groups. Correlations were examined using Pearson’s correlation coefficient analysis. Associations between gene expression and clinicopathologic factors were assessed using Fisher’s exact test, and the correlation between gene expression and patients’ prognosis using the Log-rank (Mantel-Cox) test. Statistical significance was defined as p < 0.05.

Results

CEP55 is upregulated in OC and linked to poor prognosis

We analyzed the differentially expressed genes in 3 normal tissue samples and 6 malignant OC samples in the GSE119054 dataset (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE119054) in the NCBI database, setting the threshold Adj. p. value < 0.01 (Fig. 1A). ID conversion was performed using the Uniprot database (https://www.uniprot.org/), and the differentially expressed genes were intersected with the top 1000 Differential Genes of ovarian serous cystadenocarcinoma downloaded from the GEPIA database (http://gepia.cancer-pku.cn/index.html) according to Adj. p. value (Fig. 1B). A total of 76 intersections were found (Fig. 1C, Supplementary Material 1).

Fig. 1
figure 1

Elevated CEP55 expression is linked to poor prognosis in OC. A Volcano plot of differentially expressed genes in three normal and six OC samples from the GSE119054 dataset. B, The differentially expressed genes on chromosomes in ovarian serous cystadenocarcinoma were downloaded from the GEPIA database. C, The intersection of differentially expressed genes (adj. p. value < 0.01) in the GSE119054 dataset and the top 1000 Differential Genes (adj. p. value) downloaded from GEPIA. D, String database analysis of PPI networks of intersecting genes (high confidence 0.900). E, GEPIA database analysis of CEP55 expression in ovarian serous cystadenocarcinoma. F, The correlation between CEP55 expression and survival of OC patients was analyzed using the Kaplan-Meier Plotter database. G, CEP55 expression in tumor tissues and adjacent tissues of OC patients (n = 19) assessed using RT-qPCR. H, Correlation between high and low expression of CEP55 and patients’ survival analyzed based on the mean value of CEP55 expression in tumor tissues of OC patients (n = 19). Statistical significance was assessed using an unpaired t-test. ****p < 0.0001

Full size image

We performed protein-protein interactions (PPI) analysis (Fig. 1D) using intersecting genes in the String database (https://cn.string-db.org/cgi/input?sessionId=bWfn12uqqGXq&input_page_show_search=off), setting the highest confidence (0.900). We noted a PPI network centered on TOP2A, CEP55, KIF20A, TPX2, ZWINT, CDK1, and NEK2. The specific roles of TOP2A [11, 12], KIF20A [13, 14], TPX2 [15, 16], CDK1 [17, 18], and NEK2 [19] have been well established in OC. As for the remaining two genes (CEP55 and ZWINT), CEP55 was more significantly differentially expressed in OC samples in the GSE119054 dataset (Adj. p. value = 0.005761) and its expression was elevated in OC (LogFC = 5.4686269). The prediction in the GEPIA database showed significantly elevated expression of CEP55 in ovarian serous cystadenocarcinoma as well (Fig. 1E). As revealed by the Kaplan-Meier Plotter database (http://kmplot.com/analysis/), patients with high expression of CEP55 had a poor prognosis for (Fig. 1F).

Expression of CEP55 in our OC cohort showed that its expression was significantly elevated in tumor tissues relative to adjacent tissues (Fig. 1G). Survival of patients with high and low expression of CEP55 (based on the mean value) was evaluated, which showed that patients with low expression of CEP55 had a better prognosis (Fig. 1H). Further analysis of the clinical characteristics of the patients presented that CEP55 did not correlate with the age of the patients, while CEP55 expression can predict the status of lymph node metastasis and distal metastasis in patients with OC (Table 2).

Table 2 Associations between the mRNA expression of CEP55 and clinical characteristics of OC patients
Full size table

Knockdown of CEP55 inhibits malignant behavior of OC cells

We used lentiviral vectors packaged with three shRNAs targeting CEP55 to reduce the expression of CEP55 in A2780 and SKOV3 cells to avoid off-target effects. We chose sh-CEP55 3# for subsequent experiments (Fig. 2A). First, we analyzed the effect of CEP55 on cell proliferation, downregulation of CEP55 inhibited the colony-forming ability of cells (Fig. 2B), and EdU staining further verified the impaired cell proliferation (Fig. 2C). RT-qPCR examination of the proliferation-associated factors KI67 and PCNA in cells demonstrated that deletion of CEP55 decreased expression of KI67 and PCNA (Fig. 2D). Finally, TUNEL showed that decreased CEP55 induced cell apoptosis (Fig. 2E).

Fig. 2
figure 2

CEP55 inhibits the malignant behavior of OC cells. A, CEP55 expression in A2780 and SKOV3 cells infected with lentiviral vectors harboring CEP55 knockdown assessed using RT-qPCR. B, The number of A2780 and SKOV3 cells-formed colonies was assessed using colony formation assay. C, The proliferation of A2780 and SKOV3 cells was assessed using an EdU assay. D, The expression of proliferation-related genes KI67 and PCNA in A2780 and SKOV3 cells with knockdown of CEP55 was assessed using RT-qPCR. E, Percentage of apoptosis in A2780 and SKOV3 cells with knockdown of CEP55 detected by TUNEL assay. Statistical significance was assessed using ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. All cell experiments were repeated three times

Full size image

Knockdown of CEP55 induces cell cycle arrest and suppresses EMT in OC cells

We analyzed the cell cycle alterations in OC cells after the knockdown of CEP55 using flow cytometry and the knockdown of CEP55 led to cell cycle arrest in G0/G1 phase and a decrease in the percentage of cells in S phase (Fig. 3A). Analysis of P21 and Cyclin D1 showed that deletion of CEP55 induced a downregulation in Cyclin D1 expression and an elevation in P21 expression (Fig. 3B). The cell migration and invasion were examined using Transwell assays. The reduction of CEP55 resulted in the blockage of cell migration and invasion (Fig. 3C-D). Phalloidin staining showed decreased cellular F-actin expression and altered cytomotor skeleton in response to CEP55 knockdown (Fig. 3E). Western blot confirmed elevated E-cadherin expression and decreased Vimentin, Snail, ZEB1, Slug, and N-cadherin expression in OC cells with CEP55 knockdown (Fig. 3F).

Fig. 3
figure 3

Knockdown of CEP55 induces cell cycle arrest and suppresses EMT in OC cells. A, Cell cycle of A2780 and SKOV3 infected by lentiviral vectors with CEP55 knockdown assessed by flow cytometry. B, Expression of cell cycle-related proteins P21 and Cyclin D1 in A2780 and SKOV3 cells infected by lentiviral vectors with CEP55 knockdown was assessed using western blot. C, Cell migration of A2780 and SKOV3 cells infected by lentiviral vectors with CEP55 knockdown was assessed using Transwell assay. D, Cell invasive capacity of A2780 and SKOV3 cells infected by lentiviral vectors with CEP55 knockdown was assessed using Transwell assay. E, Alterations in the skeleton of A2780 and SKOV3 cells infected by lentiviral vectors with CEP55 knockdown assessed using Phalloidin staining. F, Expression of E-cadherin, Vimentin, Snail, ZEB1, Slug, and N-cadherin in A2780 and SKOV3 cells infected by lentiviral vectors with CEP55 knockdown analyzed using western blot. Statistical significance was assessed using ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. All cell experiments were repeated three times

Full size image

FOXP2 mediates transcriptional repression of CEP55

We downloaded the list of transcription factors regulating CEP55 in the hTFtarget database (http://bioinfo.life.hust.edu.cn/hTFtarget#!/) and took the intersection with differentially expressed genes in the GSE119054 dataset as well as the 1000 Differential Genes in OC from the database GEPIA. There is only one intersection: FOXP2 (Fig. 4A). In the GSE119054 dataset, FOXP2 expression was significantly reduced in OC samples (LogFC = -4.9862002), while GEPIA also showed that its expression was reduced in OC (Fig. 4B). In the ChIP-seq database (http://cistrome.org/db/#/), a very significant binding peak of FOXP2 was noted at the CEP55 promoter (Fig. 4C), and the Jaspar database (https://jaspar.genereg.net/) also showed the presence of multiple binding sites at the CEP55 promoter (Fig. 4D). It suggests that FOXP2 may be involved in regulating the transcription of CEP55, but whether it plays a tumor suppressor role in OC through the transcriptional regulation of CEP55 needs to be further studied.

Fig. 4
figure 4

FOXP2 mediates transcriptional repression of CEP55. A, The intersection of transcription factors regulating CEP55 downloaded from the hTFtarget database, differentially expressed genes in the GSE119054 dataset, and Differential Genes downloaded from the GEPIA database. B, Expression of FOXP2 in ovarian serous cystadenocarcinoma analyzed by the GEPIA database. C, ChIP-seq database analysis of FOXP2 enrichment in the CEP55 promoter. D, Jaspar database analysis of FOXP2 binding sites in the CEP55 promoter. E, RT-qPCR detection of FOXP2 expression in tumor tissues and adjacent tissues of OC patients. F, Correlation between FOXP2 and CEP55 expression in OC tissues (n = 19) analyzed using Pearson’s correlation analysis. G, Expression of FOXP2 and CEP55 in cells after overexpression of FOXP2 in A2780 and SKOV3 cells detected by RT-qPCR. H, Luciferase activity in A2780 and SKOV3 cells was assessed using a dual-luciferase reporter assay. I, The binding of FOXP2 to the CEP55 promoter was analyzed using ChIP assay. Statistical significance was assessed using an unpaired t-test or ANOVA. **p < 0.01, ***p < 0.001, ****p < 0.0001. All cell experiments were repeated three times

Full size image

The expression of FOXP2 was analyzed in our cohort, which showed that FOXP2 was lowly expressed in tumor tissues (Fig. 4E) and was negatively correlated with the CEP55 expression in tumor tissues (Fig. 4F). We overexpressed FOXP2 (LV-FOXP2-OE) in A2780 and SKOV3 cells. After verifying the impact of overexpression efficacy, overexpression of FOXP2 was found to inhibit CEP55 expression (Fig. 4G). We subsequently designed luciferase reporter vectors with mutations in the binding site, and analysis of luciferase activity showed that overexpression of FOXP2 reduced luciferase activity in WT cells, while it did not affect the MUT (Fig. 4H). ChIP experiments verified the binding relationship between FOXP2 and the promoter of CEP55 (Fig. 4I).

FOXP2 mediates transcriptional repression of CEP55 to hamper OC cell mobility and EMT

We then performed functional rescue experiments in vitro, and OC cells infected with LV-FOXP2-OE were also treated with overexpression CEP55 plasmid (LV-FOXP2-OE + CEP55-OE) or control plasmid (NC-OE). After verifying the success of the intervention (Fig. 5A), we conducted colony formation, EdU, and TUNEL assays. Overexpression of FOXP2 reduced the number of colony formations (Fig. 5B), decreased EdU positivity (Fig. 5C, Supplementary Fig. 1A), and increased apoptosis (Fig. 5D, Supplementary Fig. 1B). However, overexpression of CEP55 induced the malignant aggressiveness of OC cells in the presence of FOXP2 upregulation. Overexpression of CEP55 was able to reverse overexpression of FOXP2-induced cell cycle arrest in A2780 and SKOV3 cells (Fig. 5E). Also, the levels of cell migration (Fig. 5F) and invasion (Fig. 5G) were significantly elevated after overexpression of CEP55. Phalloidin staining also showed that overexpression of FOXP2 resulted in an impaired cytoskeleton, which was mitigated by the presence of CEP55, and the cells reverted to a highly active motility phenotype in response to CEP55 (Fig. 5H). Finally, we analyzed the expression of EMT-related proteins in cells. Overexpression of CEP55 abated the blockade of EMT induced by overexpression of FOXP2, leading to a reduction in E-cadherin and an elevation in the expression of Vimentin, Snail, ZEB1, Slug, and N-cadherin (Fig. 5I).

Fig. 5
figure 5

FOXP2-mediated transcriptional repression of CEP55 impedes OC cell malignant phenotype. A, CEP55 expression after overexpression of CEP55 in A2780 and SKOV3 cells overexpressing FOXP2 was analyzed using RT-qPCR. B, Colony formation in A2780 and SKOV3 cells overexpressing both FOXP2 and CEP55 was assessed using colony formation assays. C, The proliferative capacity of A2780 and SKOV3 cells overexpressing both FOXP2 and CEP55 was evaluated using EdU staining. D, Apoptosis in A2780 and SKOV3 cells overexpressing both FOXP2 and CEP55 was evaluated using TUNEL assay. E, Cell cycle changes in A2780 and SKOV3 cells overexpressing both FOXP2 and CEP55 were detected by flow cytometry. F-G, The migration and invasion of A2780 and SKOV3 cells overexpressing both FOXP2 and CEP55 was detected by Transwell assay. H, Alterations in the cytoskeleton of A2780 and SKOV3 cells overexpressing both FOXP2 and CEP55 were assessed using Phalloidin staining. I, Expression of EMT-related proteins E-cadherin, Vimentin, Snail, ZEB1, Slug, and N-cadherin in A2780 and SKOV3 cells overexpressing both FOXP2 and CEP55 analyzed using western blot. Statistical significance was assessed using ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. All cell experiments were repeated three times

Full size image

FOXP2-mediated transcriptional repression of CEP55 impedes OC cell growth and metastasis

Considering the effect of FOXP2/CEP55 on cell cycle and EMT, female nude mice were subjected to intraperitoneal injection of OC cells. We found that tumor load in the peritoneal surface was reduced in mice injected with OC cells overexpressing FOXP2, and the weight of abdominal tumor nodules was increased in mice after overexpression of CEP55 (Fig. 6A-B). Further analysis of tumor metastasis in lung tissues by HE staining demonstrated that overexpression of FOXP2 partially prevented the lung metastasis of the tumor, and combined CEP55 overexpression led to enhanced lung metastasis (Fig. 6C). E-cadherin and P21 expression was elevated after overexpression of FOXP2, whereas Vimentin, Snail, ZEB1, Slug, N-cadherin, and Cyclin D1 expression was decreased, which was reversed by overexpression of CEP55 (Fig. 6D). RT-qPCR showed that overexpression of FOPX2 induced an elevation of FOXP2 and a decrease in CEP55 in tumor tissues, whereas overexpression of CEP55 resulted in a restoration of CEP55 (Fig. 6E).

Fig. 6
figure 6

FOXP2-mediated transcriptional repression of CEP55 impedes OC cell growth and metastasis in vivo. A, Representative images of abdominal tumors formed by SKOV3 cells in mice. B, Total weight of tumor nodules in the abdominal cavity of mice. C, HE staining analysis of metastatic nodules in mouse lung tissue. D, EMT- and cell cycle-related protein expression in abdominal tumors was assessed using western blot analysis. E, The mRNA expression of FOXP2 and CEP55 in abdominal tumors was evaluated using RT-qPCR. Statistical significance was assessed using ANOVA (n = 6). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Full size image

ALKBH5-catalyzed demethylation of FOXP2 represses its expression

To explore the cause of FOXP2 downregulation in OC, we queried the SRAMP tool (http://www.cuilab.cn/sramp/) and found multiple very high confidence m6A modification sites on FOXP2 mRNA (Fig. 7A). To further characterize the m6A modification of FOXP2 in OC, we included two m6A profiles of OC tissues (GSE119168 and GSE196748). Both datasets showed that the m6A modification level of FOXP2 was reduced in OC tissues (GSE119168: LogFC = -1.8650721, GSE196748: LogFC = -4.525927) (Fig. 7B). This evidence suggests that the deletion of FOXP2 in OC may be associated with reduced levels of m6A modification. We predicted proteins interacting with FOXP2 mRNA in the RNAINTER database (http://www.rnainter.org/). Among m6A-modified writers (METTL3, METTL14, WTAP, VIRMA, RBM15, HAKAI, ZC3H13) and eraser (FTO and ALKBH5) [20], the highest score value (0.2569) was observed for the binding relationship between ALKBH5 and FOXP2 (Fig. 7C). Patients with low expression of ALKBH5 were shown to possess a better prognosis in the Kaplan-Meier Plotter database (Fig. 7D). However, whether it is involved in cell cycle and EMT manipulation in OC by regulating FOXP2 needs to be explored.

Fig. 7
figure 7

ALKBH5-catalyzed demethylation of FOXP2 represses its expression. A, The m6A modification site of FOXP2 was analyzed using the SRAMP tool. B, Volcano plots of m6A modification differences between OC and control tissues in the GSE119168 and GSE196748 datasets. C, The interactions between FOXP2 mRNA and ALKBH5 protein predicted in the RNAINTER database. D, Correlation between ALKBH5 expression in OC and patients’ survival in the Kaplan-Meier Plotter database. E, The m6A modification of FOXP2 in tumor tissues and adjacent tissues (n = 19) of OC patients was assessed using MeRIP-qPCR. F, Expression of ALKBH5 in tumor tissues and adjacent tissues of OC patients (n = 19) detected by immunohistochemistry. G, ALKBH5 mRNA expression in A2780 and SKOV3 cells following infection with lentiviral vectors packaged with ALKBH5 knockdown was evaluated using RT-qPCR. H, FOXP2 and CEP55 mRNA expression in A2780 and SKOV3 cells following infection with lentiviral vectors packaged with ALKBH5 knockdown was evaluated using RT-qPCR. I, Effect of knockdown of ALKBH5 on m6A modification of FOXP2 analyzed by MeRIP-qPCR. J, The binding relation between ALKBH5 and FOXP2 mRNA was analyzed using RIP-qPCR. K, The effect of knockdown of ALKBH5 on FOXP2 mRNA stability was evaluated using actinomycin D-mediated RNA half-life assay. L, The effect of knockdown of ALKBH5 on luciferase activity was assessed using a dual-luciferase reporter assay. Statistical significance was assessed using an unpaired t-test or ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. All cell experiments were repeated three times

Full size image

First, we analyzed the m6A modification level of FOXP2 in the tumor and adjacent tissues (n = 19). The m6A modification of FOXP2 was reduced in OC tissues (Fig. 7E). Immunohistochemical analysis of ALKBH5 expression showed stronger levels of ALKBH5 positivity in tumor tissues than in adjacent tissues (Fig. 7F). The expression of ALKBH5 was downregulated in A2780 and SKOV3 cells. After verifying the knockdown effect and selecting the shRNA with the best efficiency (Fig. 7G), we assessed the expression of FOXP2 and CEP55. The expression of FOXP2 was elevated after knockdown of ALKBH5, while the expression of CEP55 was reduced (Fig. 7H). The m6A modification of FOXP2 was significantly enhanced in cells after knockdown of ALKBH5 (Fig. 7I), and RIP-qPCR assay demonstrated the binding relationship between ALKBH5 and FOXP2 mRNA (Fig. 7J). Further, our analysis of the mRNA stability of FOXP2 under actinomycin D treatment showed that the downregulation of ALKBH5 promoted the mRNA stability of FOXP2 (Fig. 7K). Finally, we analyzed the impact of ALKBH5 silencing on the stability of FOXP2 using a dual-luciferase reporter assay system. The luciferase activity was increased (Fig. 7L).

Knockdown of ALKBH5 leads to cell cycle arrest and inhibition of EMT in OC

The cell cycle alterations in response to ALKBH5 knockdown were assessed. Downregulation of ALKBH5 resulted in cell cycle arrest with a promotion in the percentage of cells in the G0/G1 phase and a decline in the percentage of cells in the S phase (Fig. 8A). Knockdown of ALKBH5 also enhanced P21 expression and reduced Cyclin D1 expression (Fig. 8B). ALKBH5 silencing also hampered cell migration (Fig. 8C) and invasion (Fig. 8D). The expression of F-actin in cells was reduced in response to ALKBH5 knockdown (Fig. 8E). Finally, we found that EMT-associated proteins were significantly altered in cells knocked down for ALKBH5, with an upregulation in E-cadherin and a downregulation in Vimentin, Snail, ZEB1, Slug, and N-cadherin (Fig. 8F).

Fig. 8
figure 8

Knockdown of ALKBH5 leads to cell cycle arrest and inhibits EMT in OC cells. A, Cell cycle changes in A2780 and SKOV3 cells with ALKBH5 knockdown were detected by flow cytometry. B, Cell cycle-related protein expression in A2780 and SKOV3 cells after knockdown of ALKBH5 was assessed using western blot. C-D, The migration and invasion of A2780 and SKOV3 cells after knockdown of ALKBH5 was detected by Transwell assay. E, Alterations in the cytoskeleton of A2780 and SKOV3 cells after knockdown of ALKBH5 were assessed using Phalloidin staining. F, Expression of EMT-related proteins E-cadherin, Vimentin, Snail, ZEB1, Slug, and N-cadherin in A2780 and SKOV3 cells after knockdown of ALKBH5 was analyzed using western blot. Statistical significance was assessed using ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. All cell experiments were repeated three times

Full size image

Discussion

Our working model (Fig. 9) posits that overexpression of ALKBH5 in OC leads to downregulation of FOXP2 via m6A demethylation. The dysregulated transcription repressor FOXP2 induces CEP55 overexpression. CEP55 then modulates the expression of cell cycle and EMT-related proteins and enhances the cytoskeleton of OC cells to support cell migration and invasion, thereby serving a central role in maintaining the mesenchymal phenotype of metastatic OC cells.

Fig. 9
figure 9

Schematic diagram. ALKBH5-mediated m6A demethylation modification induces FOXP2 degradation and blocks FOXP2-mediated CEP55 transcriptional repression, thereby promoting cell cycle and epithelial-mesenchymal transition, leading to the malignant progression of ovarian cancer

Full size image

According to Schiewek et al., the mRNA level of the cytoskeleton-associated proteins, including CEP55 was higher in malignant OC samples than in borderline or cystadenomas, and high mRNA levels of CEP55 were related to high-grading status (G2/3) of 90 OC patients [21]. We revealed here the overexpression of CEP55 in OC was related to poorer survival, lymph node metastasis, and distal metastasis. Furthermore, we found that CEP55 silencing hampered colony formation and proliferation, along with the repressed expression of PCNA and KI67. CEP55 knockdown also decreased PCNA and CDK2 levels and cell proliferation, while promoting cell apoptosis and cleaved-caspase-3/caspase-3 levels in endometrial cancer, another common gynecologic cancer [22]. After the CEP55 loss, the proliferation of gallbladder cancer cells was suppressed with cell cycle arrest in the G2/M phase and DNA damage [23]. Kalimutho et al. similarly showed that loss of CEP55 sensitized breast cancer cells to anti-mitotic agents through CDK1/cyclin B activation and CDK1 caspase-dependent mitotic cell death [24]. Our observation here showed that the accumulation of cells in the G0/G1 was accompanied by the reduction of Cyclin D1 and the rise of P21 in OC cells with CEP55 knockdown, which was also reported in pancreatic cancer cells [25] and lung cancer [26]. Our novel finding is that the cytoskeleton and EMT of OC cells were also altered by CEP55 using Phalloidin staining and western blot analysis.

As for the upstream modifiers of CEP55, long noncoding RNA SNHG12 enhanced CEP55 expression by recruiting the transcription factor E2F1 in renal cell carcinoma [27]. In this study, FOXP2 was identified as a transcription factor that both controls CEP55 expression and is differentially expressed in OC. FOXP2 mainly serves as a repressor and has a dual role in oncogenesis and cancer progression [28]. Since its limited expression in OC tissues and cells, we conducted gain-of-function assays to substantiate its function in OC. The overexpression of FOXP2 attenuated the mesenchymal phenotype, whereas the knockdown of FOXP2 promoted EMT in breast cancer cells by decreasing levels of E-cadherin and increasing levels of Vimentin [29]. Here, the suppressing effects of FOXP2 on EMT and OC cell proliferation and inducing effects on cell cycle arrest were abated by CEP55 overexpression. Knocking down FOXP2 was able to promote the protein expression of PCNA and cyclin D1 in colorectal cancer [30]. In addition, Cuiffo et al. showed that repression of FOXP2 by a network of mesenchymal stem cells-regulated microRNAs facilitated metastatic phenotypes by breast cancer cells [31]. Our in vivo studies also revealed that overexpression of FOXP2 was related to a smaller tumor burden and less metastasis dissemination to the lung. However, overexpression of CEP55 in the presence of FOXP2 overexpression played tumor-promoting and metastasis-promoting properties.

m6A is the amplest RNA modification of mRNAs and plays an essential role in many diseases, especially tumors [32]. Here, we found that ALKBH5-mediated m6A demethylation is responsible for the downregulation of FOXP2 in OC. OC patients highly expressing ALKBH5 have reduced overall survival and progression-free survival [33]. ALKBH5 overexpression enhanced tumor-associated lymphangiogenesis and lymph node metastasis by reversing the m6A modification in ITGB1 mRNA in vitro and in vivo in OC [34]. Nevertheless, its association with FOXP2 has not been investigated before, which highlighted the novelty of the study. Reduced m6A mRNA levels in human osteosarcoma cells by ALKBH5 upregulation led to cell proliferation inhibition, cell apoptosis, and cycle arrest in osteosarcoma [35]. Intriguingly, ALKBH5 has been recently revealed as both a m6A regulator and an EMT regulator in OC [36]. Here, the regulatory role of ALKBH5 in the cell cycle and EMT was corroborated in OC cells.

Conclusion

In summary, we reveal here that FOXP2 plays an indispensable role in OC and functions to suppress cancer growth and metastasis via regulating CEP55 transcription, and the expression of FOXP2 was governed by ALKBH5 in OC. The important role of ALKBH5/FOXP2/CEP55 suggests that they could serve as biomarkers for OC prognosis or even an avenue for future therapy development.

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author upon reasonable request.

Abbreviations

OC:

Ovarian cancer

CEP55:

Centrosomal protein of 55 kDa

ALKBH5:

Alpha-ketoglutarate-dependent dioxygenase alkB homolog 5

FOXP2:

Forkhead box protein P2

EMT:

Epithelial-mesenchymal transition

FBS:

Fetal bovine serum

ChIP:

Chromatin immunoprecipitation

HRP:

Horseradish peroxidase

References

  1. Lisio MA, Fu L, Goyeneche A, Gao ZH, Telleria C. High-Grade Serous Ovarian Cancer: Basic Sciences, Clinical and Therapeutic Standpoints. Int J Mol Sci. 2019;20(4).

  2. Moufarrij S, Dandapani M, Arthofer E, Gomez S, Srivastava A, Lopez-Acevedo M, et al. Epigenetic therapy for ovarian cancer: promise and progress. Clin Epigenetics. 2019;11(1):7.

    Article  PubMed  PubMed Central  Google Scholar 

  3. Tandon D, Banerjee M. Centrosomal protein 55: A new paradigm in tumorigenesis. Eur J Cell Biol. 2020;99(5):151086.

    Article  CAS  PubMed  Google Scholar 

  4. Honar YS, Javaher S, Soleimani M, Zarebkohan A, Farhadihosseinabadi B, Tohidfar M, et al. Advanced stage, high-grade primary tumor ovarian cancer: a multi-omics dissection and biomarker prediction process. Sci Rep. 2023;13(1):17265.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Loret N, Denys H, Tummers P, Berx G. The Role of Epithelial-to-Mesenchymal Plasticity in Ovarian Cancer Progression and Therapy Resistance. Cancers (Basel). 2019;11(6).

  6. Chen H, Zhu D, Zheng Z, Cai Y, Chen Z, Xie W. CEP55 promotes epithelial-mesenchymal transition in renal cell carcinoma through PI3K/AKT/mTOR pathway. Clin Transl Oncol. 2019;21(7):939–49.

    Article  CAS  PubMed  Google Scholar 

  7. Wang Y, Jin T, Dai X, Xu J. Lentivirus-mediated knockdown of CEP55 suppresses cell proliferation of breast cancer cells. Biosci Trends. 2016;10(1):67–73.

    Article  CAS  PubMed  Google Scholar 

  8. Tang Y, Thiess L, Weiler SME, Toth M, Rose F, Merker S, et al. alpha-catenin interaction with YAP/FoxM1/TEAD-induced CEP55 supports liver cancer cell migration. Cell Commun Signal. 2023;21(1):162.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Kim JH, Hwang J, Jung JH, Lee HJ, Lee DY, Kim SH. Molecular networks of FOXP family: dual biologic functions, interplay with other molecules and clinical implications in cancer progression. Mol Cancer. 2019;18(1):180.

    Article  PubMed  PubMed Central  Google Scholar 

  10. Chang LL, Xu XQ, Liu XL, Guo QQ, Fan YN, He BX, et al. Emerging role of m6A methylation modification in ovarian cancer. Cancer Cell Int. 2021;21(1):663.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Cui S, Li F. RHPN1–AS1 promotes ovarian carcinogenesis by sponging miR–6884–5p thus releasing TOP2A mRNA. Oncol Rep. 2021;46(4).

  12. Gao Y, Zhao H, Ren M, Chen Q, Li J, Li Z, et al. TOP2A Promotes Tumorigenesis of High-grade Serous Ovarian Cancer by Regulating the TGF-beta/Smad Pathway. J Cancer. 2020;11(14):4181–92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Kawai Y, Shibata K, Sakata J, Suzuki S, Utsumi F, Niimi K, et al. KIF20A expression as a prognostic indicator and its possible involvement in the proliferation of ovarian clear–cell carcinoma cells. Oncol Rep. 2018;40(1):195–205.

    CAS  PubMed  PubMed Central  Google Scholar 

  14. Li Y, Guo H, Wang Z, Bu H, Wang S, Wang H, et al. Cyclin F and KIF20A, FOXM1 target genes, increase proliferation and invasion of ovarian cancer cells. Exp Cell Res. 2020;395(2):112212.

    Article  CAS  PubMed  Google Scholar 

  15. Ma S, Rong X, Gao F, Yang Y, Wei L. TPX2 promotes cell proliferation and migration via PLK1 in OC. Cancer Biomark. 2018;22(3):443–51.

    Article  CAS  PubMed  Google Scholar 

  16. Meng X, Cao J, Zheng H, Ma X, Wang Y, Tong Y, et al. TPX2 promotes ovarian tumorigenesis by interacting with Lamin A/C and affecting its stability. Cancer Med. 2023;12(8):9738–48.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Chen S, Wu W, Li QH, Xie BM, Shen F, Du YP, et al. Circ-NOLC1 promotes epithelial ovarian cancer tumorigenesis and progression by binding ESRP1 and modulating CDK1 and RhoA expression. Cell Death Discov. 2021;7(1):22.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Yanaihara N, Yoshino Y, Noguchi D, Tabata J, Takenaka M, Iida Y, et al. Paclitaxel sensitizes homologous recombination-proficient ovarian cancer cells to PARP inhibitor via the CDK1/BRCA1 pathway. Gynecol Oncol. 2023;168:83–91.

    Article  CAS  PubMed  Google Scholar 

  19. Xia B, Zhao Z, Wu Y, Wang Y, Zhao Y, Wang J. Circular RNA circTNPO3 Regulates Paclitaxel Resistance of Ovarian Cancer Cells by miR-1299/NEK2 Signaling Pathway. Mol Ther Nucleic Acids. 2020;21:780–91.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Murakami S, Jaffrey SR. Hidden codes in mRNA: Control of gene expression by m(6)A. Mol Cell. 2022;82(12):2236–51.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Schiewek J, Schumacher U, Lange T, Joosse SA, Wikman H, Pantel K, et al. Clinical relevance of cytoskeleton associated proteins for ovarian cancer. J Cancer Res Clin Oncol. 2018;144(11):2195–205.

    Article  CAS  PubMed  Google Scholar 

  22. Zhang X, Xu Q, Li E, Shi T, Chen H. CEP55 predicts the poor prognosis and promotes tumorigenesis in endometrial cancer by regulating the Foxo1 signaling. Mol Cell Biochem. 2023;478(7):1561–71.

    Article  CAS  PubMed  Google Scholar 

  23. Huang M, Zhong F, Chen M, Hong L, Chen W, Abudukeremu X, et al. CEP55 as a promising biomarker and therapeutic target on gallbladder cancer. Front Oncol. 2023;13:1156177.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Kalimutho M, Sinha D, Jeffery J, Nones K, Srihari S, Fernando WC et al. CEP55 is a determinant of cell fate during perturbed mitosis in breast cancer. EMBO Mol Med. 2018;10(9).

  25. Peng T, Zhou W, Guo F, Wu HS, Wang CY, Wang L, et al. Centrosomal protein 55 activates NF-kappaB signalling and promotes pancreatic cancer cells aggressiveness. Sci Rep. 2017;7(1):5925.

    Article  PubMed  PubMed Central  Google Scholar 

  26. Liu L, Mei Q, Zhao J, Dai Y, Fu Q. Suppression of CEP55 reduces cell viability and induces apoptosis in human lung cancer. Oncol Rep. 2016;36(4):1939–45.

    Article  CAS  PubMed  Google Scholar 

  27. Feng JF, Wang J, Xie G, Wang YD, Li XH, Yang WY, et al. KMT2B promotes the growth of renal cell carcinoma via upregulation of SNHG12 expression and promotion of CEP55 transcription. Cancer Cell Int. 2022;22(1):197.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Bach DH, Long NP, Luu TT, Anh NH, Kwon SW, Lee SK. The Dominant Role of Forkhead Box Proteins in Cancer. Int J Mol Sci. 2018;19(10).

  29. Liu Y, Chen T, Guo M, Li Y, Zhang Q, Tan G, et al. FOXA2-Interacting FOXP2 Prevents Epithelial-Mesenchymal Transition of Breast Cancer Cells by Stimulating E-Cadherin and PHF2 Transcription. Front Oncol. 2021;11:605025.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Liao P, Huang WH, Cao L, Wang T, Chen LM. Low expression of FOXP2 predicts poor survival and targets caspase-1 to inhibit cell pyroptosis in colorectal cancer. J Cancer. 2022;13(4):1181–92.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Cuiffo BG, Campagne A, Bell GW, Lembo A, Orso F, Lien EC, et al. MSC-regulated microRNAs converge on the transcription factor FOXP2 and promote breast cancer metastasis. Cell Stem Cell. 2014;15(6):762–74.

    Article  CAS  PubMed  Google Scholar 

  32. Guo J, Zheng J, Zhang H, Tong J. RNA m6A methylation regulators in ovarian cancer. Cancer Cell Int. 2021;21(1):609.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Qu J, Yan H, Hou Y, Cao W, Liu Y, Zhang E, et al. RNA demethylase ALKBH5 in cancer: from mechanisms to therapeutic potential. J Hematol Oncol. 2022;15(1):8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Sun R, Yuan L, Jiang Y, Wan Y, Ma X, Yang J, et al. ALKBH5 activates FAK signaling through m6A demethylation in ITGB1 mRNA and enhances tumor-associated lymphangiogenesis and lymph node metastasis in ovarian cancer. Theranostics. 2023;13(2):833–48.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Yang Z, Cai Z, Yang C, Luo Z, Bao X. ALKBH5 regulates STAT3 activity to affect the proliferation and tumorigenicity of osteosarcoma via an m6A-YTHDF2-dependent manner. EBioMedicine. 2022;80:104019.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Zhang Y, Wang X, Duan X, Du T, Chen X. The synergistic effect of EMT regulators and m6A modification on prognosis-related immunological signatures for ovarian cancer. Sci Rep. 2023;13(1):14872.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

We thank the Zhejiang Provincial Program for the Cultivation of High-Level Innovative Health Talents (2022–175). Taizhou Science and Technology Project, Zhejiang Province (23ywb24, 21ywa34) for the funding support.

Funding

This study was supported by the Zhejiang Provincial Program for the Cultivation of High-Level Innovative Health Talents (2022–175). Taizhou Science and Technology Project, Zhejiang Province (23ywb24, 21ywa34).

Author information

Authors and Affiliations

  1. Department of Obstetrics and Gynecology, Taizhou Hospital Zhejiang Province, Wenzhou Medical University, Linhai, Zhejiang Province, 317000, China

    Junhui Yu, Xing Chen, Kang Lin, Tianxin Zhang & Kai Wang

  2. Department of Hematologic Oncology, Taizhou Central Hospital, (Taizhou University Hospital), Taizhou, Zhejiang Province, 318000, China

    Xiaoxiao Ding

Authors
  1. Junhui Yu
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Xing Chen
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Xiaoxiao Ding
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Kang Lin
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Tianxin Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Kai Wang
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Junhui Yu: Conceptualization, Formal analysis, Funding acquisition, Writing–original draft. Xing Chen: Investigation, Data curation, Visualization. Xiaoxiao Ding: Methodology, Software, Writing–review & editing. Kang Lin: Resources, Visualization, Writing–review & and editing. Tianxin Zhang: Investigation, Methodology, Validation. Kai Wang: Funding acquisition, Writing–review & editing. All authors have read and approved the final version of the manuscript.

Corresponding author

Correspondence to Kai Wang.

Ethics declarations

Ethics approval and consent to participate

All cases were diagnosed by an independent pathologist. The current study was approved by the Ethics Review Committee of Taizhou Hospital, Zhejiang Province (approval no. TZ20170123) and performed following the Declaration of Helsinki. All participants signed informed consent documentation. All animal-related procedures were permitted by the Institutional Animal Care and Use Committee of Taizhou Hospital, Zhejiang Province (approval no. TZ20231012).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Supplementary Material 2

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Yu, J., Chen, X., Ding, X. et al. ALKBH5 activates CEP55 transcription through m6A demethylation in FOXP2 mRNA and expedites cell cycle entry and EMT in ovarian cancer. Biol Direct 19, 105 (2024). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13062-024-00551-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13062-024-00551-5

Keywords

Biology Direct

ISSN: 1745-6150

Contact us